Incidental Mutation 'R0086:Atp13a1'
ID19898
Institutional Source Beutler Lab
Gene Symbol Atp13a1
Ensembl Gene ENSMUSG00000031862
Gene NameATPase type 13A1
SynonymsCgi152, Atp13a, catp
MMRRC Submission 038373-MU
Accession Numbers

Ncbi RefSeq: NM_133224.2; MGI: 2180801

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0086 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location69791163-69807749 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 69797774 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 381 (I381N)
Ref Sequence ENSEMBL: ENSMUSP00000034326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034326]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034326
AA Change: I381N

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000034326
Gene: ENSMUSG00000031862
AA Change: I381N

DomainStartEndE-ValueType
low complexity region 54 62 N/A INTRINSIC
transmembrane domain 64 86 N/A INTRINSIC
transmembrane domain 96 118 N/A INTRINSIC
Pfam:E1-E2_ATPase 264 515 3.2e-24 PFAM
Pfam:Hydrolase 524 781 2.2e-11 PFAM
Pfam:HAD 527 870 2.7e-27 PFAM
low complexity region 883 894 N/A INTRINSIC
transmembrane domain 1045 1067 N/A INTRINSIC
transmembrane domain 1093 1115 N/A INTRINSIC
transmembrane domain 1130 1147 N/A INTRINSIC
low complexity region 1173 1184 N/A INTRINSIC
Meta Mutation Damage Score 0.9438 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.0%
  • 10x: 94.6%
  • 20x: 86.6%
Validation Efficiency 96% (91/95)
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik T A 15: 82,062,601 V233D probably benign Het
Abcg8 T C 17: 84,692,771 V252A probably damaging Het
Adam39 C T 8: 40,826,360 T596I possibly damaging Het
Agap2 C A 10: 127,087,882 probably null Het
Ap4b1 T G 3: 103,814,860 V50G probably damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Birc6 T C 17: 74,593,166 V1113A possibly damaging Het
C1galt1 T A 6: 7,867,051 probably benign Het
Capza2 A G 6: 17,660,774 K158E probably damaging Het
Cenpe C T 3: 135,264,424 probably benign Het
Cercam T C 2: 29,871,064 L42P probably damaging Het
Cfap54 T C 10: 93,028,594 E807G possibly damaging Het
Cog6 A G 3: 52,993,570 V157A probably damaging Het
Cts6 A T 13: 61,196,457 probably benign Het
Cyp2c39 A T 19: 39,510,913 I15F unknown Het
Dock7 A T 4: 98,945,144 V1970D probably damaging Het
Exph5 A G 9: 53,337,930 D73G possibly damaging Het
Gjc2 A T 11: 59,176,846 M270K probably benign Het
Gns G A 10: 121,391,473 D463N probably damaging Het
Hoxd8 G T 2: 74,705,932 G129W probably damaging Het
Ina A G 19: 47,023,591 T483A possibly damaging Het
Lmod3 T A 6: 97,247,345 Q505L probably damaging Het
Map3k13 A G 16: 21,914,225 N526D probably damaging Het
Map3k2 A T 18: 32,218,468 I435F probably damaging Het
Mfsd6l A G 11: 68,556,565 T81A probably benign Het
Micall1 T C 15: 79,125,489 probably benign Het
Mkrn2 G T 6: 115,613,335 M217I possibly damaging Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Ncapg A G 5: 45,676,744 probably null Het
Nlrp9a G A 7: 26,558,547 C530Y probably damaging Het
Numb T C 12: 83,795,930 T442A probably damaging Het
Oip5 C T 2: 119,617,929 probably benign Het
Olfr1224-ps1 C T 2: 89,156,476 R233H probably benign Het
Olfr342 A T 2: 36,527,450 I13F possibly damaging Het
Olfr639 A G 7: 104,012,054 I216T probably benign Het
Olfr936 T C 9: 39,046,895 T175A probably benign Het
Pcnx T C 12: 81,992,058 probably benign Het
Pkhd1l1 T A 15: 44,556,008 N2956K possibly damaging Het
Plcl1 T A 1: 55,715,583 W1030R probably damaging Het
Polr2i G A 7: 30,233,086 V73M probably damaging Het
Prr14l T A 5: 32,831,559 probably benign Het
Pxdn G T 12: 30,002,419 R865L possibly damaging Het
Scnn1a T C 6: 125,342,587 probably benign Het
Shkbp1 G T 7: 27,352,026 H203N probably benign Het
Skiv2l2 G T 13: 112,927,328 F10L probably benign Het
Slc22a14 C T 9: 119,222,738 probably benign Het
Snap29 C A 16: 17,428,236 T240K probably damaging Het
Sp2 C A 11: 96,957,427 G457C probably damaging Het
Ssr2 C T 3: 88,576,880 probably benign Het
Synpo2 A T 3: 123,117,104 C297* probably null Het
Tpm3 T A 3: 90,090,092 probably benign Het
Trmt6 CTG C 2: 132,809,017 probably benign Het
Trp63 T C 16: 25,871,087 Y431H probably damaging Het
Tuba3b T A 6: 145,621,160 C376S probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Ulk1 G A 5: 110,787,707 probably benign Het
Usp24 T C 4: 106,392,360 S1425P probably damaging Het
Xdh T C 17: 73,884,438 I1335V probably benign Het
Zmynd15 T C 11: 70,464,232 Y352H probably damaging Het
Other mutations in Atp13a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Atp13a1 APN 8 69796897 missense probably damaging 1.00
IGL00949:Atp13a1 APN 8 69800003 splice site probably benign
IGL01122:Atp13a1 APN 8 69798905 missense probably damaging 1.00
IGL02399:Atp13a1 APN 8 69807101 missense probably damaging 1.00
IGL02616:Atp13a1 APN 8 69805313 missense probably benign
IGL03073:Atp13a1 APN 8 69798502 missense probably damaging 1.00
yun_nan UTSW 8 69798679 missense probably damaging 1.00
P0005:Atp13a1 UTSW 8 69803747 missense possibly damaging 0.88
R0384:Atp13a1 UTSW 8 69797324 missense possibly damaging 0.89
R0973:Atp13a1 UTSW 8 69802144 critical splice donor site probably null
R0973:Atp13a1 UTSW 8 69802144 critical splice donor site probably null
R0974:Atp13a1 UTSW 8 69802144 critical splice donor site probably null
R2010:Atp13a1 UTSW 8 69791360 missense possibly damaging 0.77
R2040:Atp13a1 UTSW 8 69807052 missense possibly damaging 0.76
R2069:Atp13a1 UTSW 8 69799773 missense probably benign 0.00
R4274:Atp13a1 UTSW 8 69805292 missense probably benign
R4288:Atp13a1 UTSW 8 69794078 missense possibly damaging 0.89
R4470:Atp13a1 UTSW 8 69798679 missense probably damaging 1.00
R5408:Atp13a1 UTSW 8 69796840 missense probably benign 0.41
R5916:Atp13a1 UTSW 8 69807098 missense probably damaging 1.00
R5920:Atp13a1 UTSW 8 69800096 missense probably benign 0.02
R5951:Atp13a1 UTSW 8 69797285 missense probably damaging 1.00
R6143:Atp13a1 UTSW 8 69805360 missense probably benign
R6467:Atp13a1 UTSW 8 69806774 missense probably damaging 1.00
R6487:Atp13a1 UTSW 8 69799878 missense probably damaging 0.99
R7166:Atp13a1 UTSW 8 69799316 splice site probably null
R7652:Atp13a1 UTSW 8 69805559 missense probably damaging 0.97
R8014:Atp13a1 UTSW 8 69799779 nonsense probably null
R8228:Atp13a1 UTSW 8 69798919 missense probably damaging 1.00
RF001:Atp13a1 UTSW 8 69800070 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GCTGGAGTCATTGCCATAGGAGTC -3'
(R):5'- GGATGTGTTGAACCCAGTTCTCAGG -3'

Sequencing Primer
(F):5'- CATTGCCATAGGAGTCTGGAGC -3'
(R):5'- GGCCACACATCCATTGTCG -3'
Posted On2013-04-11