Mutagenetix > Incidental Mutation

Incidental Mutation 'R1902:Igf1r'

212341

Institutional Source

Beutler Lab

Gene Symbol

Igf1r

Ensembl Gene

ENSMUSG00000005533

Gene Name

insulin-like growth factor I receptor

Synonyms

line 186, A330103N21Rik, CD221, hyft, IGF-1R

MMRRC Submission

039922-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1902 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

67952827-68233668 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 68201249 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 931 (Y931H)

Ref Sequence

ENSEMBL: ENSMUSP00000005671 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005671]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000005671
AA Change: Y931H

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000005671
Gene: ENSMUSG00000005533
AA Change: Y931H

Domain	Start	End	E-Value	Type
Pfam:Recep_L_domain	51	161	1.6e-29	PFAM
FU	227	270	2.98e-12	SMART
Pfam:Recep_L_domain	353	467	3.8e-32	PFAM
FN3	490	593	4.67e-2	SMART
FN3	612	815	1.95e-4	SMART
FN3	833	915	7.4e-5	SMART
low complexity region	937	954	N/A	INTRINSIC
TyrKc	1000	1268	8.51e-141	SMART
low complexity region	1285	1303	N/A	INTRINSIC
low complexity region	1306	1319	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208348

Coding Region Coverage

1x: 97.3%
3x: 96.7%
10x: 94.9%
20x: 91.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This receptor binds insulin-like growth factor with a high affinity. It has tyrosine kinase activity. The insulin-like growth factor I receptor plays a critical role in transformation events. Cleavage of the precursor generates alpha and beta subunits. It is highly overexpressed in most malignant tissues where it functions as an anti-apoptotic agent by enhancing cell survival. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Targeted null mutants die at birth of respiratory failure; fetuses exhibit retarded growth, organ hypoplasia, ossification delay and nervous system and epidermal abnormalities. hyft homozygous fetuses are growth retarded and exhibit hydrops fetalis and focal hepatic ischemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 128 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730507C01Rik	C	T	12: 18,534,003	Q355*	probably null	Het
Acacb	A	T	5: 114,165,734	R73*	probably null	Het
Adra1a	T	C	14: 66,638,235	S220P	probably benign	Het
Ano2	A	T	6: 125,872,684	E126D	probably damaging	Het
Anpep	C	T	7: 79,838,256	E518K	probably benign	Het
Arhgap45	C	A	10: 80,025,466	Q488K	probably damaging	Het
Arhgef7	C	A	8: 11,808,713		probably null	Het
Atxn7l3b	A	G	10: 112,928,673	I17T	probably benign	Het
BC003331	T	A	1: 150,388,609		probably null	Het
Bpifb9a	A	T	2: 154,261,991	N118I	probably benign	Het
Btbd9	A	T	17: 30,530,228	D37E	probably damaging	Het
C8a	T	C	4: 104,856,601		probably null	Het
Capn13	G	A	17: 73,326,361	S535F	probably damaging	Het
Carns1	G	T	19: 4,166,338	P615Q	probably damaging	Het
Casz1	T	C	4: 148,936,195	I479T	possibly damaging	Het
Ccdc88a	G	T	11: 29,461,788	M532I	probably benign	Het
Cdc42bpb	T	G	12: 111,326,016	S362R	probably damaging	Het
Ceacam11	A	T	7: 17,975,327	H150L	probably benign	Het
Cfap44	A	C	16: 44,422,374	T714P	probably benign	Het
Cnot1	T	C	8: 95,743,121	I1369V	possibly damaging	Het
Cpeb1	T	C	7: 81,372,119	D92G	probably benign	Het
Cped1	T	A	6: 22,120,981		probably null	Het
Csf1r	A	G	18: 61,130,141	T896A	probably damaging	Het
Csf3r	T	C	4: 126,042,918	F658S	probably damaging	Het
Cts6	A	T	13: 61,201,515	Y126*	probably null	Het
Cul7	T	C	17: 46,655,740	L365P	probably damaging	Het
Cxcl5	T	C	5: 90,759,785	V72A	probably damaging	Het
Cyp4v3	T	A	8: 45,306,952	H521L	probably benign	Het
Dct	T	C	14: 118,034,278	N380S	probably benign	Het
Dnah1	T	C	14: 31,319,759	D85G	probably damaging	Het
Dnah7a	T	C	1: 53,535,478	D1709G	probably damaging	Het
Dnaic1	A	T	4: 41,625,319	K428*	probably null	Het
Dsc1	A	T	18: 20,095,988	V415D	probably damaging	Het
E2f8	T	C	7: 48,871,172	H467R	probably benign	Het
Eddm3b	T	A	14: 51,116,864	I103N	probably damaging	Het
Fam71b	A	T	11: 46,407,011	T381S	probably benign	Het
Gal3st2c	T	G	1: 94,008,889	N185K	probably damaging	Het
Ganc	T	C	2: 120,446,482	L675P	probably damaging	Het
Gdf9	G	A	11: 53,436,953	M245I	probably benign	Het
Gm21886	G	A	18: 80,089,418	T175I	probably damaging	Het
Gria2	A	G	3: 80,722,108	L269P	probably damaging	Het
Grm8	T	C	6: 27,429,482	Y471C	probably damaging	Het
Gucy2g	T	A	19: 55,210,237	T825S	probably benign	Het
H2-Bl	A	T	17: 36,083,953	M16K	probably damaging	Het
Iffo2	T	C	4: 139,607,701	S124P	probably damaging	Het
Il22ra1	A	T	4: 135,750,908	Q430L	probably damaging	Het
Il23r	A	C	6: 67,423,734	D537E	probably benign	Het
Ip6k1	G	A	9: 108,040,996	E77K	possibly damaging	Het
Itgb4	T	C	11: 115,980,738	V179A	probably damaging	Het
Itpr2	T	A	6: 146,229,703	H1968L	probably damaging	Het
Kdm4a	A	G	4: 118,160,399	V490A	probably benign	Het
Kif13a	A	T	13: 46,788,162	D946E	probably benign	Het
Klhl22	T	A	16: 17,771,787	I104N	probably damaging	Het
Klk6	A	C	7: 43,826,057	M1L	probably benign	Het
Krt78	A	T	15: 101,946,963	C804*	probably null	Het
Larp7	A	T	3: 127,540,578	N533K	probably damaging	Het
Lrit3	T	C	3: 129,791,246	T288A	probably benign	Het
Lrp11	T	A	10: 7,623,780	L245Q	probably damaging	Het
Lrp1b	T	C	2: 40,860,661	S2964G	probably damaging	Het
Lrrc66	C	T	5: 73,607,622	V693M	probably damaging	Het
Macf1	T	A	4: 123,471,165	M3268L	probably benign	Het
Mad1l1	A	G	5: 140,303,688	S161P	possibly damaging	Het
Mettl25	A	G	10: 105,826,087	S341P	probably damaging	Het
Morc3	A	G	16: 93,870,497	T588A	probably damaging	Het
Mospd3	A	G	5: 137,600,415	S21P	probably damaging	Het
Mrpl57	T	A	14: 57,826,729	F71L	probably damaging	Het
Mtbp	T	C	15: 55,606,715	L594S	probably damaging	Het
Mthfd2	T	C	6: 83,306,731	N323S	probably damaging	Het
Muc5b	G	T	7: 141,864,105	S3596I	possibly damaging	Het
Mug1	A	G	6: 121,881,821	D1166G	probably benign	Het
Nav1	T	G	1: 135,472,410	N474T	probably benign	Het
Ncoa1	A	T	12: 4,339,049	D75E	possibly damaging	Het
Ncor1	A	C	11: 62,338,158	I958S	probably damaging	Het
Nefm	T	C	14: 68,124,114	S234G	probably benign	Het
Nlrp4c	T	C	7: 6,065,819	S240P	probably damaging	Het
Nox3	C	T	17: 3,670,017	V298M	probably damaging	Het
Ntn4	A	G	10: 93,707,372	D320G	possibly damaging	Het
Nudt13	C	G	14: 20,310,641	T174R	probably damaging	Het
Olfr1002	T	C	2: 85,647,857	S155G	possibly damaging	Het
Olfr119	T	A	17: 37,701,421	H250Q	probably damaging	Het
Olfr1245	A	T	2: 89,575,603	L41Q	possibly damaging	Het
Olfr1512	T	G	14: 52,372,717	Q112P	possibly damaging	Het
Olfr209	A	T	16: 59,362,163	D18E	probably benign	Het
Olfr355	T	C	2: 36,927,185	I310V	probably benign	Het
Olfr430	T	C	1: 174,070,126	V276A	probably damaging	Het
Olfr437	T	A	6: 43,167,723		probably null	Het
Olfr812	G	T	10: 129,842,506	P179T	probably benign	Het
Olfr967	T	C	9: 39,750,806	V140A	probably benign	Het
Opn1sw	T	A	6: 29,379,804	N144Y	possibly damaging	Het
Osbpl5	T	C	7: 143,703,181	D404G	possibly damaging	Het
Parp14	C	T	16: 35,853,518		probably null	Het
Pde3a	C	A	6: 141,498,770	N1101K	probably benign	Het
Plcb1	G	A	2: 134,813,613	V38I	possibly damaging	Het
Plec	T	A	15: 76,175,551	E3417D	probably damaging	Het
Ppfibp2	C	T	7: 107,746,378	P869L	probably damaging	Het
Ppp1r12a	T	A	10: 108,198,891	I99N	probably damaging	Het
Pramel5	G	A	4: 144,273,863	Q48*	probably null	Het
Prr13	C	A	15: 102,460,698		probably benign	Het
Psg22	T	A	7: 18,724,438	Y312*	probably null	Het
Ptchd4	A	T	17: 42,503,616	I803L	probably benign	Het
Rasa4	A	G	5: 136,091,238	D56G	probably benign	Het
Rif1	T	A	2: 52,116,673	N2206K	possibly damaging	Het
Robo1	A	G	16: 72,960,204	Q351R	probably null	Het
Samd4	T	C	14: 47,074,128	F81S	probably damaging	Het
Sh3pxd2b	T	C	11: 32,423,559	*909Q	probably null	Het
Slc25a45	A	G	19: 5,884,522	R173G	probably damaging	Het
Smarca1	G	A	X: 47,849,963	Q723*	probably null	Het
Smoc1	T	C	12: 81,104,671	I54T	probably benign	Het
Spef2	G	T	15: 9,607,377	R1319S	probably damaging	Het
Steap3	T	G	1: 120,241,734	I240L	probably benign	Het
Stmn4	C	T	14: 66,355,609	L13F	probably damaging	Het
Stxbp5	C	A	10: 9,812,298	V420F	possibly damaging	Het
Syt3	T	C	7: 44,390,516	S58P	possibly damaging	Het
Tas2r125	T	C	6: 132,910,176	F176L	probably benign	Het
Tbc1d19	T	A	5: 53,829,353	C35S	probably benign	Het
Tcaf3	T	C	6: 42,593,552	E422G	possibly damaging	Het
Tekt4	T	A	17: 25,471,858	F46Y	possibly damaging	Het
Tnfaip3	T	C	10: 19,008,189	K148E	probably benign	Het
Trrap	T	G	5: 144,816,053	I1813R	probably damaging	Het
Ttc29	A	G	8: 78,251,732	E137G	probably benign	Het
Tubgcp6	C	A	15: 89,116,241	R307L	possibly damaging	Het
Tyro3	T	C	2: 119,801,695	I81T	possibly damaging	Het
Upp2	T	G	2: 58,771,452	M71R	probably damaging	Het
Utp20	G	T	10: 88,753,026	T2427K	probably benign	Het
Vcl	T	A	14: 20,982,699	L122Q	probably damaging	Het
Vmn1r213	A	C	13: 23,012,306	N353T	possibly damaging	Het
Vwa5b2	G	T	16: 20,604,832	S1165I	possibly damaging	Het
Zfp869	T	C	8: 69,707,438	K162E	probably benign	Het

Other mutations in Igf1r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00742:Igf1r	APN	7	68190023	missense	probably benign
IGL00837:Igf1r	APN	7	68201352	splice site	probably benign
IGL01515:Igf1r	APN	7	68207452	missense	probably damaging	1.00
IGL01572:Igf1r	APN	7	68193441	missense	probably benign	0.01
IGL02100:Igf1r	APN	7	68189958	missense	probably benign	0.05
IGL02506:Igf1r	APN	7	68193396	missense	probably benign
IGL02672:Igf1r	APN	7	68190033	missense	probably benign	0.05
IGL02701:Igf1r	APN	7	68201249	missense	possibly damaging	0.93
IGL02742:Igf1r	APN	7	68189991	missense	possibly damaging	0.94
IGL03073:Igf1r	APN	7	68215043	missense	probably damaging	1.00
IGL03257:Igf1r	APN	7	68214940	missense	probably damaging	1.00
Frufru	UTSW	7	68004163	missense	probably damaging	1.00
Hungarian	UTSW	7	68214997	missense	probably damaging	1.00
Mimi	UTSW	7	68195026	missense	possibly damaging	0.67
Piroshka	UTSW	7	68207336	nonsense	probably null
Romanian	UTSW	7	68004137	missense	possibly damaging	0.94
Sublime	UTSW	7	68004179	missense	probably damaging	1.00
Toy	UTSW	7	68003972	missense	probably damaging	1.00
BB009:Igf1r	UTSW	7	68212054	missense	possibly damaging	0.88
BB019:Igf1r	UTSW	7	68212054	missense	possibly damaging	0.88
FR4548:Igf1r	UTSW	7	68226186	small insertion	probably benign
FR4737:Igf1r	UTSW	7	68226181	small insertion	probably benign
FR4976:Igf1r	UTSW	7	68226181	small insertion	probably benign
FR4976:Igf1r	UTSW	7	68226186	small insertion	probably benign
PIT4445001:Igf1r	UTSW	7	68207463	missense	probably damaging	1.00
R0003:Igf1r	UTSW	7	68165242	missense	probably damaging	1.00
R0184:Igf1r	UTSW	7	68226193	missense	possibly damaging	0.84
R0538:Igf1r	UTSW	7	68207826	missense	probably damaging	1.00
R0632:Igf1r	UTSW	7	68165155	missense	probably damaging	1.00
R0727:Igf1r	UTSW	7	68212158	critical splice donor site	probably null
R0750:Igf1r	UTSW	7	68212091	missense	probably damaging	0.99
R1104:Igf1r	UTSW	7	68195026	missense	possibly damaging	0.67
R1169:Igf1r	UTSW	7	68165127	missense	probably benign	0.00
R1348:Igf1r	UTSW	7	68218468	missense	probably damaging	1.00
R1471:Igf1r	UTSW	7	68003837	missense	probably damaging	0.98
R1580:Igf1r	UTSW	7	68207869	missense	probably benign
R1745:Igf1r	UTSW	7	68169913	missense	probably damaging	1.00
R1772:Igf1r	UTSW	7	68195074	missense	probably benign	0.03
R1789:Igf1r	UTSW	7	68214933	nonsense	probably null
R1823:Igf1r	UTSW	7	68194981	missense	possibly damaging	0.77
R1962:Igf1r	UTSW	7	68207275	missense	probably damaging	0.99
R2179:Igf1r	UTSW	7	68003950	missense	probably damaging	0.99
R2215:Igf1r	UTSW	7	68165234	missense	probably benign
R2221:Igf1r	UTSW	7	68201962	missense	probably damaging	1.00
R2233:Igf1r	UTSW	7	68212080	missense	probably damaging	1.00
R2234:Igf1r	UTSW	7	68212080	missense	probably damaging	1.00
R2235:Igf1r	UTSW	7	68212080	missense	probably damaging	1.00
R3023:Igf1r	UTSW	7	68183399	missense	probably benign	0.00
R4044:Igf1r	UTSW	7	68190062	missense	possibly damaging	0.83
R4226:Igf1r	UTSW	7	68195078	nonsense	probably null
R4387:Igf1r	UTSW	7	68170009	missense	probably benign
R4388:Igf1r	UTSW	7	68170009	missense	probably benign
R4728:Igf1r	UTSW	7	68189624	missense	probably damaging	1.00
R4781:Igf1r	UTSW	7	68165199	missense	possibly damaging	0.75
R5254:Igf1r	UTSW	7	68207319	missense	probably damaging	0.99
R5278:Igf1r	UTSW	7	68193418	missense	possibly damaging	0.78
R5510:Igf1r	UTSW	7	68193359	missense	probably benign	0.19
R5522:Igf1r	UTSW	7	68183510	missense	probably damaging	0.96
R5527:Igf1r	UTSW	7	68207821	missense	probably damaging	1.00
R5761:Igf1r	UTSW	7	68207253	missense	probably damaging	1.00
R5849:Igf1r	UTSW	7	68190033	missense	probably benign
R6189:Igf1r	UTSW	7	68207336	nonsense	probably null
R6262:Igf1r	UTSW	7	68003972	missense	probably damaging	1.00
R6285:Igf1r	UTSW	7	68004137	missense	possibly damaging	0.94
R6318:Igf1r	UTSW	7	68165233	missense	probably benign	0.02
R6365:Igf1r	UTSW	7	68190050	missense	probably benign	0.26
R6377:Igf1r	UTSW	7	68201250	missense	probably benign	0.00
R6831:Igf1r	UTSW	7	68207319	missense	possibly damaging	0.75
R6848:Igf1r	UTSW	7	68004179	missense	probably damaging	1.00
R6902:Igf1r	UTSW	7	68004163	missense	probably damaging	1.00
R7193:Igf1r	UTSW	7	68187157	missense	probably damaging	1.00
R7373:Igf1r	UTSW	7	68195078	nonsense	probably null
R7442:Igf1r	UTSW	7	68173278	missense	probably damaging	1.00
R7903:Igf1r	UTSW	7	68184752	missense	probably damaging	1.00
R7923:Igf1r	UTSW	7	68190101	missense	probably damaging	1.00
R7932:Igf1r	UTSW	7	68212054	missense	possibly damaging	0.88
R8368:Igf1r	UTSW	7	68187048	missense	probably benign	0.03
R8458:Igf1r	UTSW	7	68195629	missense	probably benign
R8539:Igf1r	UTSW	7	68003848	missense	probably benign	0.06
R8704:Igf1r	UTSW	7	68170054	splice site	probably benign
R8746:Igf1r	UTSW	7	68214997	missense	probably damaging	1.00
R8829:Igf1r	UTSW	7	68226021	missense	probably damaging	1.00
R8832:Igf1r	UTSW	7	68226021	missense	probably damaging	1.00
R8859:Igf1r	UTSW	7	68183463	missense	possibly damaging	0.75
R9057:Igf1r	UTSW	7	68183438	missense	probably damaging	1.00
R9243:Igf1r	UTSW	7	68212027	missense	probably benign	0.11
R9342:Igf1r	UTSW	7	68194998	missense	probably benign	0.00
R9412:Igf1r	UTSW	7	68207253	missense	probably damaging	1.00
R9525:Igf1r	UTSW	7	68214934	missense	probably damaging	1.00
R9727:Igf1r	UTSW	7	68207806	missense	probably damaging	1.00
R9730:Igf1r	UTSW	7	68189675	missense	probably damaging	1.00
R9779:Igf1r	UTSW	7	68004317	missense	probably damaging	1.00
RF025:Igf1r	UTSW	7	68226179	small insertion	probably benign
RF032:Igf1r	UTSW	7	68226179	small insertion	probably benign
RF034:Igf1r	UTSW	7	68226176	small insertion	probably benign
RF037:Igf1r	UTSW	7	68226176	small insertion	probably benign
RF039:Igf1r	UTSW	7	68226176	small insertion	probably benign
RF044:Igf1r	UTSW	7	68226179	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226168	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226169	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226174	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226180	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226182	small insertion	probably benign
Z1191:Igf1r	UTSW	7	68226169	small insertion	probably benign
Z1191:Igf1r	UTSW	7	68226170	small insertion	probably benign
Z1191:Igf1r	UTSW	7	68226173	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- TGGTCTTGTCCCAGCACTAG -3'
(R):5'- ATGTCTGACTAGGAACTCTGGCTG -3'

Sequencing Primer
(F):5'- GGTCTTGTCCCAGCACTAGAAGAC -3'
(R):5'- ATGGTATTTTCCCCCACAGACGAG -3'

Posted On

2014-06-30