Mutagenetix > Incidental Mutations

Incidental Mutation 'R2092:Akap13'

231838

Institutional Source

Beutler Lab

Gene Symbol

Akap13

Ensembl Gene

ENSMUSG00000066406

Gene Name

A kinase (PRKA) anchor protein 13

Synonyms

AKAP-Lbc, 5730522G15Rik, 1700026G02Rik, PROTO-LBC, PROTO-LB, Ht31, 5830460E08Rik

MMRRC Submission

040097-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2092 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

75455534-75754609 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 75610570 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 178 (I178F)

Ref Sequence

ENSEMBL: ENSMUSP00000146990 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166315] [ENSMUST00000207750] [ENSMUST00000207923]

Predicted Effect

probably benign
Transcript: ENSMUST00000147005
AA Change: I981F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000117686
Gene: ENSMUSG00000066406
AA Change: I981F

Domain	Start	End	E-Value	Type
low complexity region	174	184	N/A	INTRINSIC
internal_repeat_1	485	695	4.85e-5	PROSPERO
low complexity region	773	789	N/A	INTRINSIC
low complexity region	896	908	N/A	INTRINSIC
low complexity region	1021	1032	N/A	INTRINSIC
Pfam:RII_binding_1	1218	1235	4.3e-6	PFAM
low complexity region	1429	1444	N/A	INTRINSIC
low complexity region	1479	1501	N/A	INTRINSIC
low complexity region	1601	1612	N/A	INTRINSIC
low complexity region	1738	1768	N/A	INTRINSIC
C1	1773	1819	1.95e-4	SMART
low complexity region	1876	1887	N/A	INTRINSIC
RhoGEF	1979	2171	1.28e-61	SMART
PH	2213	2316	2.94e-11	SMART
coiled coil region	2326	2363	N/A	INTRINSIC
low complexity region	2411	2430	N/A	INTRINSIC
low complexity region	2462	2472	N/A	INTRINSIC
coiled coil region	2551	2664	N/A	INTRINSIC
low complexity region	2746	2752	N/A	INTRINSIC
low complexity region	2758	2771	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000166315
AA Change: I981F

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000129784
Gene: ENSMUSG00000066406
AA Change: I981F

Domain	Start	End	E-Value	Type
low complexity region	174	184	N/A	INTRINSIC
low complexity region	773	789	N/A	INTRINSIC
low complexity region	896	908	N/A	INTRINSIC
low complexity region	1021	1032	N/A	INTRINSIC
low complexity region	1433	1448	N/A	INTRINSIC
low complexity region	1483	1505	N/A	INTRINSIC
low complexity region	1583	1594	N/A	INTRINSIC
low complexity region	1720	1750	N/A	INTRINSIC
C1	1755	1801	1.95e-4	SMART
low complexity region	1858	1869	N/A	INTRINSIC
RhoGEF	1961	2153	1.28e-61	SMART
PH	2195	2298	2.94e-11	SMART
coiled coil region	2308	2345	N/A	INTRINSIC
low complexity region	2393	2412	N/A	INTRINSIC
low complexity region	2444	2454	N/A	INTRINSIC
coiled coil region	2533	2646	N/A	INTRINSIC
low complexity region	2728	2734	N/A	INTRINSIC
low complexity region	2740	2753	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207079

Predicted Effect

probably benign
Transcript: ENSMUST00000207750
AA Change: I981F

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

Predicted Effect

probably benign
Transcript: ENSMUST00000207923
AA Change: I178F

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208053

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208182

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208456

Predicted Effect

probably benign
Transcript: ENSMUST00000208708

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms containing c-terminal dbl oncogene homology (DH) and pleckstrin homology (PH) domains. The DH domain is associated with guanine nucleotide exchange activation for the Rho/Rac family of small GTP binding proteins, resulting in the conversion of the inactive GTPase to the active form capable of transducing signals. The PH domain has multiple functions. Therefore, these isoforms function as scaffolding proteins to coordinate a Rho signaling pathway, function as protein kinase A-anchoring proteins and, in addition, enhance ligand-dependent activity of estrogen receptors alpha and beta. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis, arrested heart development, and forebrain hypoplasia. Heterozygous mice exhibit small spleen, impaired lymphocyte response to osmotic stress, decreased response to glucocorticoid, osteoporosis and impared osteogenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	T	A	6: 121,674,937	C1321*	probably null	Het
Abca8b	A	G	11: 109,966,708	F673L	possibly damaging	Het
Adam19	T	G	11: 46,060,904		probably null	Het
AI987944	T	C	7: 41,374,617	T313A	possibly damaging	Het
Alb	G	GA	5: 90,463,983		probably null	Het
Bod1l	A	G	5: 41,831,517	S416P	probably damaging	Het
Casr	A	T	16: 36,510,043	Y310N	possibly damaging	Het
Cela3a	T	C	4: 137,404,426	N152S	probably benign	Het
Chrdl2	T	A	7: 100,020,977	C102*	probably null	Het
Col4a4	G	A	1: 82,498,946	S554L	unknown	Het
Col6a4	T	C	9: 106,060,331	K1392R	probably damaging	Het
Dab1	T	G	4: 104,678,777	Y128D	probably damaging	Het
Dars	A	T	1: 128,374,018	M293K	probably damaging	Het
Dlec1	T	C	9: 119,121,844	F493L	possibly damaging	Het
Dmbt1	G	T	7: 131,050,018	W330L	probably damaging	Het
Dnah11	A	T	12: 118,012,716	M831K	possibly damaging	Het
Dock7	T	C	4: 99,009,308	N715S	possibly damaging	Het
Edc4	T	A	8: 105,887,528	L12Q	probably damaging	Het
Edem2	T	C	2: 155,709,049	M333V	probably benign	Het
Fpr-rs4	CAGGAA	CA	17: 18,022,334		probably null	Het
Fto	C	A	8: 91,409,687	Y194*	probably null	Het
Gnptab	T	G	10: 88,440,305	Y1151*	probably null	Het
Grm1	A	G	10: 10,689,225	L1113P	probably benign	Het
Hnrnpa0	T	C	13: 58,127,800	K172E	probably damaging	Het
Ifitm1	A	G	7: 140,969,514	D70G	probably damaging	Het
Irx4	C	A	13: 73,265,486	T25K	probably damaging	Het
Kif22	C	T	7: 127,033,630	D195N	probably damaging	Het
Lrp2	C	T	2: 69,536,021	D245N	probably benign	Het
Lyz1	C	T	10: 117,288,599	R144Q	probably benign	Het
Macf1	T	A	4: 123,383,178	T6055S	probably damaging	Het
Mrgpra2b	C	T	7: 47,464,160	V249I	probably benign	Het
Myh9	G	A	15: 77,764,350	Q80*	probably null	Het
Myo6	G	T	9: 80,245,682	R199L	probably damaging	Het
Naglu	G	A	11: 101,076,720	V499I	possibly damaging	Het
Nfkbie	T	C	17: 45,558,539	F140S	probably benign	Het
Olfr1208	A	G	2: 88,897,267	F110S	probably damaging	Het
Olfr1454	T	A	19: 13,063,802	Y130*	probably null	Het
Olfr510	CAAATA	CA	7: 108,667,662		probably null	Het
Olfr598	G	A	7: 103,329,109	V208M	probably damaging	Het
Olfr67	A	T	7: 103,788,072	F68L	possibly damaging	Het
Olfr935	A	T	9: 38,995,189	L82Q	probably damaging	Het
Otop1	A	T	5: 38,299,766	I290F	probably damaging	Het
P2rx2	C	T	5: 110,341,141	D203N	probably damaging	Het
Pcdhb10	T	A	18: 37,414,187	I772N	probably benign	Het
Pnliprp1	A	G	19: 58,741,184	H423R	probably benign	Het
Ptk2	A	T	15: 73,236,191	Y56*	probably null	Het
Rapgef3	T	C	15: 97,760,723	D134G	probably damaging	Het
Scaf11	A	C	15: 96,415,827	S1358A	probably damaging	Het
Scn9a	T	C	2: 66,533,376	M844V	probably damaging	Het
Sh3tc1	T	C	5: 35,700,658	E1121G	probably damaging	Het
Slc25a15	T	C	8: 22,380,934	T176A	probably damaging	Het
Slc29a4	T	A	5: 142,718,855	I384N	probably damaging	Het
Slc40a1	A	T	1: 45,909,454	D555E	probably benign	Het
Smc5	T	C	19: 23,238,899	I446V	probably benign	Het
St6gal2	T	C	17: 55,510,266	Y477H	probably damaging	Het
Syngr1	A	T	15: 80,115,940	Q84L	possibly damaging	Het
Tedc1	T	C	12: 113,157,720	L187P	probably damaging	Het
Tg	A	G	15: 66,849,607	I322V	probably null	Het
Thap12	T	C	7: 98,716,449	V608A	possibly damaging	Het
Tmbim6	T	C	15: 99,402,068	S22P	probably damaging	Het
Ttc3	C	T	16: 94,442,832	P1232S	probably benign	Het
Upk3a	A	G	15: 85,018,085	T38A	probably damaging	Het
Utrn	A	T	10: 12,678,698	M1549K	probably benign	Het
Vmn1r176	C	T	7: 23,835,153	D192N	probably damaging	Het
Vmn1r198	A	G	13: 22,354,715	T35A	possibly damaging	Het
Xkr7	C	T	2: 153,054,063	S279L	probably damaging	Het
Zer1	G	A	2: 30,108,274	L342F	probably damaging	Het
Zfp641	G	T	15: 98,293,712	T31N	probably benign	Het
Zfp74	G	A	7: 29,953,924		probably benign	Het

Other mutations in Akap13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Akap13	APN	7	75725971	missense	probably damaging	0.99
IGL00332:Akap13	APN	7	75728919	missense	probably damaging	1.00
IGL00481:Akap13	APN	7	75723895	missense	probably damaging	1.00
IGL00590:Akap13	APN	7	75610669	missense	probably benign	0.01
IGL00655:Akap13	APN	7	75704398	missense	probably damaging	0.99
IGL00766:Akap13	APN	7	75704512	missense	probably damaging	0.96
IGL00818:Akap13	APN	7	75609727	missense	probably benign	0.00
IGL00826:Akap13	APN	7	75677447	missense	probably damaging	1.00
IGL01014:Akap13	APN	7	75750633	utr 3 prime	probably benign
IGL01090:Akap13	APN	7	75666531	missense	probably benign	0.44
IGL01155:Akap13	APN	7	75569936	missense	probably damaging	1.00
IGL01326:Akap13	APN	7	75725348	missense	probably benign	0.30
IGL01456:Akap13	APN	7	75602847	missense	probably damaging	0.98
IGL01460:Akap13	APN	7	75747846	missense	probably benign	0.29
IGL01568:Akap13	APN	7	75608522	nonsense	probably null	0.00
IGL01610:Akap13	APN	7	75720180	missense	possibly damaging	0.71
IGL01610:Akap13	APN	7	75747605	missense	probably damaging	1.00
IGL01615:Akap13	APN	7	75697393	missense	probably damaging	1.00
IGL01667:Akap13	APN	7	75570019	missense	probably damaging	1.00
IGL01705:Akap13	APN	7	75746767	missense	possibly damaging	0.86
IGL02070:Akap13	APN	7	75666545	missense	probably benign	0.27
IGL02269:Akap13	APN	7	75602911	missense	probably benign
IGL02421:Akap13	APN	7	75717806	missense	possibly damaging	0.66
IGL02870:Akap13	APN	7	75609188	missense	probably damaging	0.96
IGL02944:Akap13	APN	7	75608657	missense	probably benign
IGL03051:Akap13	APN	7	75610485	nonsense	probably null
IGL03160:Akap13	APN	7	75730417	missense	probably damaging	1.00
IGL03245:Akap13	APN	7	75609752	missense	probably damaging	0.99
R0254:Akap13	UTSW	7	75736604	splice site	probably benign
R0310:Akap13	UTSW	7	75614930	missense	probably damaging	0.99
R0373:Akap13	UTSW	7	75609929	missense	probably benign	0.00
R0373:Akap13	UTSW	7	75730500	missense	probably damaging	1.00
R0408:Akap13	UTSW	7	75746796	missense	probably damaging	1.00
R0631:Akap13	UTSW	7	75614996	missense	probably damaging	0.99
R0646:Akap13	UTSW	7	75747746	missense	probably damaging	1.00
R0781:Akap13	UTSW	7	75611377	missense	possibly damaging	0.56
R0845:Akap13	UTSW	7	75725380	missense	probably damaging	1.00
R1004:Akap13	UTSW	7	75687286	missense	probably damaging	0.99
R1024:Akap13	UTSW	7	75677409	missense	probably damaging	1.00
R1110:Akap13	UTSW	7	75611377	missense	possibly damaging	0.56
R1346:Akap13	UTSW	7	75609592	missense	possibly damaging	0.67
R1349:Akap13	UTSW	7	75609592	missense	possibly damaging	0.67
R1372:Akap13	UTSW	7	75609592	missense	possibly damaging	0.67
R1387:Akap13	UTSW	7	75586193	missense	probably damaging	0.97
R1442:Akap13	UTSW	7	75735778	missense	probably damaging	0.99
R1466:Akap13	UTSW	7	75729049	missense	possibly damaging	0.79
R1466:Akap13	UTSW	7	75729049	missense	possibly damaging	0.79
R1584:Akap13	UTSW	7	75729049	missense	possibly damaging	0.79
R1696:Akap13	UTSW	7	75609592	missense	possibly damaging	0.67
R1738:Akap13	UTSW	7	75677194	missense	probably damaging	1.00
R1773:Akap13	UTSW	7	75683451	missense	possibly damaging	0.80
R1785:Akap13	UTSW	7	75611434	missense	probably benign	0.16
R1786:Akap13	UTSW	7	75611434	missense	probably benign	0.16
R1791:Akap13	UTSW	7	75611035	missense	probably benign	0.00
R1819:Akap13	UTSW	7	75608705	missense	probably benign	0.04
R1879:Akap13	UTSW	7	75610727	missense	probably benign	0.01
R1989:Akap13	UTSW	7	75704516	missense	probably benign	0.01
R2016:Akap13	UTSW	7	75704531	missense	probably damaging	0.99
R2126:Akap13	UTSW	7	75725304	missense	possibly damaging	0.95
R2131:Akap13	UTSW	7	75611434	missense	probably benign	0.16
R2132:Akap13	UTSW	7	75611434	missense	probably benign	0.16
R2133:Akap13	UTSW	7	75611434	missense	probably benign	0.16
R2251:Akap13	UTSW	7	75739477	missense	possibly damaging	0.50
R3704:Akap13	UTSW	7	75666550	missense	probably damaging	1.00
R3713:Akap13	UTSW	7	75586181	missense	probably damaging	0.98
R3731:Akap13	UTSW	7	75611377	missense	probably benign	0.39
R3765:Akap13	UTSW	7	75608837	missense	probably benign	0.04
R3788:Akap13	UTSW	7	75702153	critical splice donor site	probably null
R3793:Akap13	UTSW	7	75610141	missense	probably benign	0.00
R3970:Akap13	UTSW	7	75569951	nonsense	probably null
R4205:Akap13	UTSW	7	75610919	missense	probably benign	0.05
R4257:Akap13	UTSW	7	75611285	missense	probably damaging	0.98
R4374:Akap13	UTSW	7	75608984	missense	probably damaging	0.96
R4448:Akap13	UTSW	7	75742760	missense	probably damaging	1.00
R4450:Akap13	UTSW	7	75742760	missense	probably damaging	1.00
R4457:Akap13	UTSW	7	75739465	missense	probably damaging	0.99
R4458:Akap13	UTSW	7	75739465	missense	probably damaging	0.99
R4466:Akap13	UTSW	7	75602773	splice site	probably null
R4632:Akap13	UTSW	7	75666553	missense	possibly damaging	0.91
R4667:Akap13	UTSW	7	75729094	missense	probably damaging	1.00
R4669:Akap13	UTSW	7	75729094	missense	probably damaging	1.00
R4671:Akap13	UTSW	7	75579564	nonsense	probably null
R4821:Akap13	UTSW	7	75677507	intron	probably benign
R4868:Akap13	UTSW	7	75743504	missense	probably damaging	1.00
R4894:Akap13	UTSW	7	75725320	missense	possibly damaging	0.76
R4943:Akap13	UTSW	7	75749240	missense	probably benign	0.22
R4962:Akap13	UTSW	7	75749430	missense	probably damaging	0.98
R4988:Akap13	UTSW	7	75730528	missense	probably damaging	1.00
R5119:Akap13	UTSW	7	75687252	missense	probably damaging	0.98
R5141:Akap13	UTSW	7	75609614	missense	probably benign	0.18
R5419:Akap13	UTSW	7	75610243	missense	probably benign	0.01
R5427:Akap13	UTSW	7	75728869	missense	possibly damaging	0.89
R5429:Akap13	UTSW	7	75602904	missense	possibly damaging	0.70
R5432:Akap13	UTSW	7	75602830	missense	probably damaging	1.00
R5458:Akap13	UTSW	7	75586301	missense	probably damaging	1.00
R5636:Akap13	UTSW	7	75704372	missense	probably damaging	0.96
R5643:Akap13	UTSW	7	75702154	critical splice donor site	probably null
R5898:Akap13	UTSW	7	75729146	missense	probably damaging	1.00
R5932:Akap13	UTSW	7	75610184	missense	probably damaging	1.00
R6135:Akap13	UTSW	7	75609908	missense	possibly damaging	0.94
R6137:Akap13	UTSW	7	75677416	missense	probably damaging	1.00
R6182:Akap13	UTSW	7	75586280	missense	probably benign	0.45
R6310:Akap13	UTSW	7	75749193	missense	probably damaging	0.99
R6346:Akap13	UTSW	7	75685254	missense	probably damaging	1.00
R6466:Akap13	UTSW	7	75727044	missense	probably benign	0.01
R6605:Akap13	UTSW	7	75579768	missense	probably damaging	0.98
R6617:Akap13	UTSW	7	75730363	missense	possibly damaging	0.95
R6621:Akap13	UTSW	7	75569981	missense	probably damaging	1.00
R6703:Akap13	UTSW	7	75602898	missense	probably damaging	1.00
R6750:Akap13	UTSW	7	75739458	missense	probably benign	0.03
R7069:Akap13	UTSW	7	75610262	missense	probably benign	0.29
R7116:Akap13	UTSW	7	75720195	missense	probably benign	0.00
R7158:Akap13	UTSW	7	75579594	missense	probably damaging	0.97
R7159:Akap13	UTSW	7	75730579	missense	possibly damaging	0.72
R7467:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7468:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7471:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7472:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7477:Akap13	UTSW	7	75749247	missense	probably benign
R7636:Akap13	UTSW	7	75609873	missense	probably benign	0.04
R7650:Akap13	UTSW	7	75643454	missense	probably benign	0.20
R7671:Akap13	UTSW	7	75569900	missense	probably damaging	1.00
R7681:Akap13	UTSW	7	75728796	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- GAAAGTTCCACAGCTCTGGG -3'
(R):5'- TACAATGGAGTGCCTCAGACG -3'

Sequencing Primer
(F):5'- CACAGCTCTGGGGCAAGATG -3'
(R):5'- TGCCTCAGACGCACCTG -3'

Posted On

2014-09-18