Incidental Mutation 'R2092:Dock7'
ID231818
Institutional Source Beutler Lab
Gene Symbol Dock7
Ensembl Gene ENSMUSG00000028556
Gene Namededicator of cytokinesis 7
Synonyms3110056M06Rik, m, LOC242555
MMRRC Submission 040097-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2092 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location98936671-99120915 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99009308 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 715 (N715S)
Ref Sequence ENSEMBL: ENSMUSP00000145604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030286] [ENSMUST00000075836] [ENSMUST00000127417] [ENSMUST00000127946] [ENSMUST00000205650]
Predicted Effect probably benign
Transcript: ENSMUST00000030286
AA Change: N715S

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000030286
Gene: ENSMUSG00000028556
AA Change: N715S

DomainStartEndE-ValueType
Pfam:DUF3398 67 159 6.5e-30 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 557 736 1.8e-51 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1135 1163 N/A INTRINSIC
low complexity region 1350 1364 N/A INTRINSIC
low complexity region 1543 1565 N/A INTRINSIC
Pfam:DHR-2 1571 2095 1.4e-217 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000075836
AA Change: N715S
SMART Domains Protein: ENSMUSP00000075233
Gene: ENSMUSG00000028556
AA Change: N715S

DomainStartEndE-ValueType
Pfam:DUF3398 65 159 5.8e-34 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 556 737 3.3e-58 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1105 1133 N/A INTRINSIC
low complexity region 1320 1334 N/A INTRINSIC
low complexity region 1513 1535 N/A INTRINSIC
Pfam:Ded_cyto 1888 2065 6.5e-80 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000124466
AA Change: N131S
Predicted Effect unknown
Transcript: ENSMUST00000127417
AA Change: N715S
SMART Domains Protein: ENSMUSP00000117797
Gene: ENSMUSG00000028556
AA Change: N715S

DomainStartEndE-ValueType
low complexity region 140 162 N/A INTRINSIC
Pfam:Ded_cyto 517 694 3e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127946
SMART Domains Protein: ENSMUSP00000119103
Gene: ENSMUSG00000028556

DomainStartEndE-ValueType
low complexity region 56 66 N/A INTRINSIC
low complexity region 129 140 N/A INTRINSIC
low complexity region 155 168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131386
Predicted Effect probably benign
Transcript: ENSMUST00000150254
SMART Domains Protein: ENSMUSP00000114204
Gene: ENSMUSG00000028556

DomainStartEndE-ValueType
low complexity region 74 84 N/A INTRINSIC
low complexity region 147 158 N/A INTRINSIC
low complexity region 173 186 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153362
Predicted Effect possibly damaging
Transcript: ENSMUST00000205650
AA Change: N715S

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a guanine nucleotide exchange factor (GEF) that plays a role in axon formation and neuronal polarization. The encoded protein displays GEF activity toward RAC1 and RAC3 Rho small GTPases but not toward CDC42. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for mutations of this gene exhibit coat color dilution, white tail tip, and on some genetic backgrounds a white belly spot. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,674,937 C1321* probably null Het
Abca8b A G 11: 109,966,708 F673L possibly damaging Het
Adam19 T G 11: 46,060,904 probably null Het
AI987944 T C 7: 41,374,617 T313A possibly damaging Het
Akap13 A T 7: 75,610,570 I178F probably benign Het
Alb G GA 5: 90,463,983 probably null Het
Bod1l A G 5: 41,831,517 S416P probably damaging Het
Casr A T 16: 36,510,043 Y310N possibly damaging Het
Cela3a T C 4: 137,404,426 N152S probably benign Het
Chrdl2 T A 7: 100,020,977 C102* probably null Het
Col4a4 G A 1: 82,498,946 S554L unknown Het
Col6a4 T C 9: 106,060,331 K1392R probably damaging Het
Dab1 T G 4: 104,678,777 Y128D probably damaging Het
Dars A T 1: 128,374,018 M293K probably damaging Het
Dlec1 T C 9: 119,121,844 F493L possibly damaging Het
Dmbt1 G T 7: 131,050,018 W330L probably damaging Het
Dnah11 A T 12: 118,012,716 M831K possibly damaging Het
Edc4 T A 8: 105,887,528 L12Q probably damaging Het
Edem2 T C 2: 155,709,049 M333V probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Fto C A 8: 91,409,687 Y194* probably null Het
Gnptab T G 10: 88,440,305 Y1151* probably null Het
Grm1 A G 10: 10,689,225 L1113P probably benign Het
Hnrnpa0 T C 13: 58,127,800 K172E probably damaging Het
Ifitm1 A G 7: 140,969,514 D70G probably damaging Het
Irx4 C A 13: 73,265,486 T25K probably damaging Het
Kif22 C T 7: 127,033,630 D195N probably damaging Het
Lrp2 C T 2: 69,536,021 D245N probably benign Het
Lyz1 C T 10: 117,288,599 R144Q probably benign Het
Macf1 T A 4: 123,383,178 T6055S probably damaging Het
Mrgpra2b C T 7: 47,464,160 V249I probably benign Het
Myh9 G A 15: 77,764,350 Q80* probably null Het
Myo6 G T 9: 80,245,682 R199L probably damaging Het
Naglu G A 11: 101,076,720 V499I possibly damaging Het
Nfkbie T C 17: 45,558,539 F140S probably benign Het
Olfr1208 A G 2: 88,897,267 F110S probably damaging Het
Olfr1454 T A 19: 13,063,802 Y130* probably null Het
Olfr510 CAAATA CA 7: 108,667,662 probably null Het
Olfr598 G A 7: 103,329,109 V208M probably damaging Het
Olfr67 A T 7: 103,788,072 F68L possibly damaging Het
Olfr935 A T 9: 38,995,189 L82Q probably damaging Het
Otop1 A T 5: 38,299,766 I290F probably damaging Het
P2rx2 C T 5: 110,341,141 D203N probably damaging Het
Pcdhb10 T A 18: 37,414,187 I772N probably benign Het
Pnliprp1 A G 19: 58,741,184 H423R probably benign Het
Ptk2 A T 15: 73,236,191 Y56* probably null Het
Rapgef3 T C 15: 97,760,723 D134G probably damaging Het
Scaf11 A C 15: 96,415,827 S1358A probably damaging Het
Scn9a T C 2: 66,533,376 M844V probably damaging Het
Sh3tc1 T C 5: 35,700,658 E1121G probably damaging Het
Slc25a15 T C 8: 22,380,934 T176A probably damaging Het
Slc29a4 T A 5: 142,718,855 I384N probably damaging Het
Slc40a1 A T 1: 45,909,454 D555E probably benign Het
Smc5 T C 19: 23,238,899 I446V probably benign Het
St6gal2 T C 17: 55,510,266 Y477H probably damaging Het
Syngr1 A T 15: 80,115,940 Q84L possibly damaging Het
Tedc1 T C 12: 113,157,720 L187P probably damaging Het
Tg A G 15: 66,849,607 I322V probably null Het
Thap12 T C 7: 98,716,449 V608A possibly damaging Het
Tmbim6 T C 15: 99,402,068 S22P probably damaging Het
Ttc3 C T 16: 94,442,832 P1232S probably benign Het
Upk3a A G 15: 85,018,085 T38A probably damaging Het
Utrn A T 10: 12,678,698 M1549K probably benign Het
Vmn1r176 C T 7: 23,835,153 D192N probably damaging Het
Vmn1r198 A G 13: 22,354,715 T35A possibly damaging Het
Xkr7 C T 2: 153,054,063 S279L probably damaging Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp641 G T 15: 98,293,712 T31N probably benign Het
Zfp74 G A 7: 29,953,924 probably benign Het
Other mutations in Dock7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Dock7 APN 4 99063985 missense probably damaging 1.00
IGL01126:Dock7 APN 4 98973552 splice site probably benign
IGL01490:Dock7 APN 4 98945118 unclassified probably benign
IGL01553:Dock7 APN 4 98945566 nonsense probably null
IGL01728:Dock7 APN 4 98962331 missense probably damaging 1.00
IGL01776:Dock7 APN 4 98940941 missense possibly damaging 0.65
IGL01954:Dock7 APN 4 99083151 missense probably damaging 0.99
IGL01985:Dock7 APN 4 99023377 missense probably benign 0.35
IGL02054:Dock7 APN 4 98973409 missense probably damaging 1.00
IGL02150:Dock7 APN 4 99079852 splice site probably benign
IGL02153:Dock7 APN 4 98958067 missense probably benign 0.15
IGL02183:Dock7 APN 4 98958991 missense possibly damaging 0.89
IGL02494:Dock7 APN 4 98989234 missense probably benign 0.18
IGL02618:Dock7 APN 4 99083028 missense probably benign 0.00
IGL02634:Dock7 APN 4 98989296 missense probably damaging 1.00
IGL02670:Dock7 APN 4 98966286 splice site probably null
IGL02690:Dock7 APN 4 98969635 missense possibly damaging 0.95
IGL02692:Dock7 APN 4 98987386 missense probably damaging 1.00
IGL02833:Dock7 APN 4 98945495 missense probably damaging 1.00
IGL02858:Dock7 APN 4 98945205 nonsense probably null
IGL02875:Dock7 APN 4 98975994 missense probably benign 0.00
IGL03027:Dock7 APN 4 98977927 missense probably benign
IGL03027:Dock7 APN 4 99070213 missense possibly damaging 0.71
IGL03032:Dock7 APN 4 98966348 missense probably benign 0.02
IGL03104:Dock7 APN 4 98959023 missense possibly damaging 0.60
IGL03136:Dock7 APN 4 99003791 missense probably damaging 1.00
IGL03345:Dock7 APN 4 98984819 missense possibly damaging 0.91
moonlight UTSW 4 large deletion
PIT4810001:Dock7 UTSW 4 98945559 nonsense probably null
R0086:Dock7 UTSW 4 98945144 missense probably damaging 1.00
R0242:Dock7 UTSW 4 98962280 missense probably benign
R0242:Dock7 UTSW 4 98962280 missense probably benign
R0245:Dock7 UTSW 4 99055349 missense possibly damaging 0.64
R0308:Dock7 UTSW 4 98984814 missense probably benign 0.07
R0556:Dock7 UTSW 4 98945189 missense probably damaging 1.00
R0612:Dock7 UTSW 4 98989233 missense probably benign 0.31
R0652:Dock7 UTSW 4 99055349 missense possibly damaging 0.64
R0669:Dock7 UTSW 4 98987479 missense probably benign 0.00
R0681:Dock7 UTSW 4 99016704 missense probably damaging 1.00
R0725:Dock7 UTSW 4 98945291 missense probably damaging 1.00
R0828:Dock7 UTSW 4 99015745 missense probably damaging 1.00
R0837:Dock7 UTSW 4 98989258 missense probably benign 0.01
R0962:Dock7 UTSW 4 98945195 missense possibly damaging 0.85
R1140:Dock7 UTSW 4 99065406 missense possibly damaging 0.82
R1476:Dock7 UTSW 4 99079435 missense possibly damaging 0.52
R1614:Dock7 UTSW 4 99061280 missense probably benign 0.12
R1625:Dock7 UTSW 4 98962196 splice site probably null
R1640:Dock7 UTSW 4 98945246 missense probably damaging 1.00
R1752:Dock7 UTSW 4 98966444 missense probably damaging 1.00
R1941:Dock7 UTSW 4 98984715 missense probably benign 0.09
R2020:Dock7 UTSW 4 98959101 missense probably damaging 1.00
R2293:Dock7 UTSW 4 98966369 missense probably damaging 1.00
R2424:Dock7 UTSW 4 98945307 nonsense probably null
R3767:Dock7 UTSW 4 98970829 missense probably benign
R3768:Dock7 UTSW 4 98970829 missense probably benign
R3769:Dock7 UTSW 4 98970829 missense probably benign
R3770:Dock7 UTSW 4 98970829 missense probably benign
R3917:Dock7 UTSW 4 99016685 missense probably damaging 1.00
R3943:Dock7 UTSW 4 98992431 missense probably damaging 1.00
R4021:Dock7 UTSW 4 99003920 splice site probably null
R4073:Dock7 UTSW 4 99008059 missense probably benign 0.02
R4170:Dock7 UTSW 4 98966401 missense probably damaging 0.99
R4180:Dock7 UTSW 4 99016736 missense probably benign 0.05
R4261:Dock7 UTSW 4 99003886 missense possibly damaging 0.78
R4321:Dock7 UTSW 4 99072454 missense probably damaging 1.00
R4522:Dock7 UTSW 4 98962224 missense probably damaging 1.00
R4582:Dock7 UTSW 4 99003916 missense possibly damaging 0.90
R4648:Dock7 UTSW 4 98969644 nonsense probably null
R4940:Dock7 UTSW 4 99020077 missense probably damaging 1.00
R5090:Dock7 UTSW 4 98991411 missense probably benign 0.04
R5374:Dock7 UTSW 4 98989038 missense possibly damaging 0.81
R5392:Dock7 UTSW 4 99008006 missense probably damaging 1.00
R5527:Dock7 UTSW 4 98953868 intron probably benign
R5544:Dock7 UTSW 4 98967257 missense probably damaging 1.00
R5556:Dock7 UTSW 4 98944735 missense probably damaging 1.00
R5870:Dock7 UTSW 4 99063962 missense probably benign 0.00
R5899:Dock7 UTSW 4 98991423 missense probably benign
R6360:Dock7 UTSW 4 98969662 missense probably benign 0.02
R6415:Dock7 UTSW 4 98992448 missense probably damaging 1.00
R6468:Dock7 UTSW 4 98967227 missense probably benign 0.15
R6562:Dock7 UTSW 4 98991410 missense probably damaging 0.97
R6613:Dock7 UTSW 4 98977960 missense probably damaging 0.99
R6703:Dock7 UTSW 4 98946672 missense probably damaging 1.00
R6723:Dock7 UTSW 4 99003916 missense possibly damaging 0.90
R6786:Dock7 UTSW 4 99061292 missense probably benign 0.42
R7026:Dock7 UTSW 4 99078919 missense probably benign
R7051:Dock7 UTSW 4 98946732 missense probably damaging 1.00
R7074:Dock7 UTSW 4 98945208 missense unknown
R7106:Dock7 UTSW 4 98967326 missense unknown
R7147:Dock7 UTSW 4 98961417 missense unknown
R7257:Dock7 UTSW 4 98973412 missense unknown
R7334:Dock7 UTSW 4 98975943 missense unknown
R7511:Dock7 UTSW 4 99061282 missense
R7511:Dock7 UTSW 4 99079755 nonsense probably null
R7729:Dock7 UTSW 4 99055446 missense
X0027:Dock7 UTSW 4 99003853 missense probably damaging 0.99
Z1176:Dock7 UTSW 4 98945225 missense unknown
Predicted Primers PCR Primer
(F):5'- GAGAGCTTTACAACTCTAATTTGCC -3'
(R):5'- TCTCTCACAGCCAGTTCTGG -3'

Sequencing Primer
(F):5'- ACAACTCTAATTTGCCATATGCTAG -3'
(R):5'- GCCCAAAATTCTAGCTGTGTGTAGC -3'
Posted On2014-09-18