Mutagenetix > Incidental Mutations

Incidental Mutation 'R2353:Sin3b'

246258

Institutional Source

Beutler Lab

Gene Symbol

Sin3b

Ensembl Gene

ENSMUSG00000031622

Gene Name

transcriptional regulator, SIN3B (yeast)

Synonyms

2810430C10Rik

MMRRC Submission

040335-MU

Accession Numbers

Genbank: NM_009188, NM_001113248; MGI: 107158

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2353 (G1)

Quality Score

192

Status

Validated

Chromosome

Chromosomal Location

72723285-72758201 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 72724152 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000148599 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004494] [ENSMUST00000109950] [ENSMUST00000212095] [ENSMUST00000212096]

Predicted Effect

probably null
Transcript: ENSMUST00000004494

SMART Domains

Protein: ENSMUSP00000004494
Gene: ENSMUSG00000031622

Domain	Start	End	E-Value	Type
low complexity region	5	26	N/A	INTRINSIC
Pfam:PAH	53	97	2.5e-19	PFAM
Pfam:PAH	173	227	4.4e-20	PFAM
Pfam:PAH	313	357	1.6e-8	PFAM
HDAC_interact	384	484	2.75e-58	SMART
low complexity region	667	688	N/A	INTRINSIC
Pfam:Sin3a_C	712	1011	7.2e-81	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000109950

SMART Domains

Protein: ENSMUSP00000105576
Gene: ENSMUSG00000031622

Domain	Start	End	E-Value	Type
low complexity region	5	26	N/A	INTRINSIC
Pfam:PAH	53	97	3.4e-20	PFAM
Pfam:PAH	173	227	5.6e-21	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000212095

Predicted Effect

probably null
Transcript: ENSMUST00000212096

Meta Mutation Damage Score

0.9495

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.2%

Validation Efficiency

100% (32/32)

MGI Phenotype

PHENOTYPE: Homozygous null mice fail to survive past P1 and exhibit pallor, fetal growth retardation, impaired terminal differentiation of erythrocytes and granulocytes, a pale liver and reduced ossification of the long bones in the hindlimb. Mutant MEFs show impaired G0 arrest upon serum deprivation. [provided by MGI curators]

Allele List at MGI

All alleles(8) : Targeted, knock-out(1) Targeted, other(4) Gene trapped(3)

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl4	G	T	4: 144,623,209	E345D	probably damaging	Het
Adam7	T	A	14: 68,505,088	Q692L	probably benign	Het
AF366264	T	A	8: 13,836,951	E380V	probably damaging	Het
Ankk1	A	C	9: 49,418,690	C322G	probably benign	Het
Ap3b2	C	T	7: 81,473,850		probably benign	Het
Apeh	T	C	9: 108,086,292	D577G	possibly damaging	Het
Aspm	T	A	1: 139,477,697	W1441R	probably damaging	Het
B4galt3	C	A	1: 171,274,043	H196N	probably damaging	Het
Cd163	G	T	6: 124,319,156	E820*	probably null	Het
Cd38	T	A	5: 43,908,011		probably null	Het
Cdh15	G	A	8: 122,862,024	R279Q	probably damaging	Het
Enpp1	C	A	10: 24,651,341	Q649H	probably benign	Het
Garnl3	T	A	2: 33,064,034	R86S	probably damaging	Het
Gbe1	A	G	16: 70,437,021		probably null	Het
Gm5117	A	G	8: 31,739,195		noncoding transcript	Het
Hip1	A	T	5: 135,412,712	V568E	probably damaging	Het
Hspa14	G	A	2: 3,511,176		probably null	Het
Lrrc4	A	G	6: 28,831,452	F55L	probably benign	Het
Med31	T	A	11: 72,214,140	N35I	probably damaging	Het
Msi1	C	A	5: 115,436,509		probably benign	Het
Olfr1270	A	T	2: 90,149,718	L96Q	probably damaging	Het
Olfr394	T	C	11: 73,887,834	I179M	probably benign	Het
Parl	T	C	16: 20,287,040	T211A	probably benign	Het
Ppwd1	T	C	13: 104,213,582	I432V	probably benign	Het
Scn10a	T	A	9: 119,638,687	I796F	probably damaging	Het
Sh3rf3	A	G	10: 59,007,073	D287G	probably damaging	Het
Ubr4	T	C	4: 139,433,673	I2493T	possibly damaging	Het
Uts2	T	A	4: 151,000,136		probably null	Het
Zfp109	T	C	7: 24,229,381	D201G	probably benign	Het
Zfp407	A	G	18: 84,559,880	F1036S	probably damaging	Het
Znrf3	T	C	11: 5,281,170	E685G	probably damaging	Het

Other mutations in Sin3b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00586:Sin3b	APN	8	72757000	missense	probably benign	0.22
IGL01107:Sin3b	APN	8	72731105	missense	possibly damaging	0.74
IGL01114:Sin3b	APN	8	72744505	missense	probably benign	0.06
IGL01603:Sin3b	APN	8	72750064	missense	probably damaging	1.00
IGL01763:Sin3b	APN	8	72746608	missense	probably damaging	1.00
IGL02078:Sin3b	APN	8	72753580	missense	possibly damaging	0.49
IGL02572:Sin3b	APN	8	72744481	missense	probably benign	0.15
IGL02732:Sin3b	APN	8	72733453	missense	possibly damaging	0.72
IGL02831:Sin3b	APN	8	72744562	missense	probably damaging	1.00
IGL03064:Sin3b	APN	8	72757058	unclassified	probably benign
IGL03107:Sin3b	APN	8	72753585	missense	probably damaging	0.99
IGL03142:Sin3b	APN	8	72744568	missense	probably damaging	1.00
3-1:Sin3b	UTSW	8	72753209	missense	possibly damaging	0.95
R0070:Sin3b	UTSW	8	72725582	missense	probably damaging	1.00
R0070:Sin3b	UTSW	8	72725582	missense	probably damaging	1.00
R0226:Sin3b	UTSW	8	72744508	missense	probably benign	0.44
R0629:Sin3b	UTSW	8	72753536	splice site	probably benign
R1486:Sin3b	UTSW	8	72750513	missense	probably benign	0.00
R1524:Sin3b	UTSW	8	72753287	missense	probably benign	0.05
R1653:Sin3b	UTSW	8	72741519	missense	probably benign	0.30
R2144:Sin3b	UTSW	8	72731265	missense	probably damaging	1.00
R2180:Sin3b	UTSW	8	72753295	nonsense	probably null
R2271:Sin3b	UTSW	8	72733419	missense	probably benign	0.11
R3945:Sin3b	UTSW	8	72733439	missense	possibly damaging	0.88
R4412:Sin3b	UTSW	8	72739779	missense	probably benign	0.16
R4564:Sin3b	UTSW	8	72753581	missense	probably damaging	1.00
R4782:Sin3b	UTSW	8	72725643	missense	probably benign	0.04
R4799:Sin3b	UTSW	8	72725643	missense	probably benign	0.04
R4863:Sin3b	UTSW	8	72744948	missense	possibly damaging	0.91
R5011:Sin3b	UTSW	8	72744556	missense	probably benign	0.39
R5237:Sin3b	UTSW	8	72733343	critical splice acceptor site	probably null
R5325:Sin3b	UTSW	8	72750526	missense	probably damaging	1.00
R5725:Sin3b	UTSW	8	72725692	critical splice donor site	probably null
R5927:Sin3b	UTSW	8	72749878	missense	probably benign	0.00
R5945:Sin3b	UTSW	8	72731165	missense	probably damaging	0.97
R6492:Sin3b	UTSW	8	72733490	critical splice donor site	probably null
R7092:Sin3b	UTSW	8	72747870	critical splice donor site	probably null
R7106:Sin3b	UTSW	8	72724137	missense	possibly damaging	0.90
R7258:Sin3b	UTSW	8	72750208	missense	probably benign	0.00
R7472:Sin3b	UTSW	8	72753225	missense	probably damaging	1.00
R7475:Sin3b	UTSW	8	72749872	missense	possibly damaging	0.47
R7491:Sin3b	UTSW	8	72746441	missense	probably damaging	1.00
R7636:Sin3b	UTSW	8	72747734	nonsense	probably null
R8063:Sin3b	UTSW	8	72725541	missense	probably damaging	1.00
R8354:Sin3b	UTSW	8	72741480	missense	probably benign
R8454:Sin3b	UTSW	8	72741480	missense	probably benign
R8711:Sin3b	UTSW	8	72723398	missense	probably damaging	0.97
R8719:Sin3b	UTSW	8	72723511	missense	unknown
R8807:Sin3b	UTSW	8	72750080	missense	probably benign	0.00
X0017:Sin3b	UTSW	8	72731165	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- AACACCGCAGTTATCCTCG -3'
(R):5'- GGAATCCCATCAGTTCCTCAG -3'

Sequencing Primer
(F):5'- AGTTATCCTCGCGGCCC -3'
(R):5'- GAACCACCTCATCTTGCGACTG -3'

Posted On

2014-10-30