Incidental Mutation 'R1439:Mroh2a'
ID250593
Institutional Source Beutler Lab
Gene Symbol Mroh2a
Ensembl Gene ENSMUSG00000079429
Gene Namemaestro heat-like repeat family member 2A
SynonymsHeatr7b1, ENSMUSG00000044873, OTTMUSG00000020804
MMRRC Submission 039494-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.921) question?
Stock #R1439 (G1)
Quality Score62
Status Validated
Chromosome1
Chromosomal Location88226986-88262289 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 88257802 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 1510 (E1510D)
Ref Sequence ENSEMBL: ENSMUSP00000108755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054674] [ENSMUST00000061013] [ENSMUST00000113130] [ENSMUST00000135948]
Predicted Effect probably benign
Transcript: ENSMUST00000054674
SMART Domains Protein: ENSMUSP00000054263
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 11 68 1.5e-10 PFAM
low complexity region 159 175 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
Pfam:HJURP_mid 254 370 7.6e-54 PFAM
Pfam:HJURP_C 385 446 3.1e-26 PFAM
low complexity region 496 515 N/A INTRINSIC
Pfam:HJURP_C 527 585 7.1e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000061013
AA Change: E1518D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429
AA Change: E1518D

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1235 1248 N/A INTRINSIC
SCOP:d1jdha_ 1371 1669 9e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113130
AA Change: E1510D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429
AA Change: E1510D

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1232 1245 N/A INTRINSIC
SCOP:d1gw5a_ 1446 1671 6e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000135948
AA Change: E15D

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118971
Gene: ENSMUSG00000079429
AA Change: E15D

DomainStartEndE-ValueType
SCOP:d1gw5a_ 15 174 5e-6 SMART
Meta Mutation Damage Score 0.1363 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.3%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a HEAT-domain-containing protein. The function of the encoded protein has not been characterized. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,843,186 N499S probably damaging Het
AI661453 C A 17: 47,466,662 probably benign Het
Akap1 C A 11: 88,844,751 G362* probably null Het
Alkbh1 A G 12: 87,429,145 V289A probably damaging Het
Bnc2 C T 4: 84,276,068 E1035K probably benign Het
C1s2 T A 6: 124,630,167 probably benign Het
C530008M17Rik T C 5: 76,840,910 V36A probably damaging Het
Cabin1 A G 10: 75,656,806 I1885T probably damaging Het
Col22a1 A G 15: 71,952,377 probably benign Het
Cpne4 A T 9: 104,989,632 T248S probably damaging Het
Cubn T C 2: 13,287,568 N3268S probably damaging Het
Ddx10 T A 9: 53,240,487 K79N probably damaging Het
Dennd1a A C 2: 38,043,400 L131R probably damaging Het
Dnah9 T C 11: 65,874,132 Y3862C probably benign Het
Eif3e A G 15: 43,278,428 probably benign Het
Emsy T C 7: 98,600,841 probably benign Het
Ep400 A T 5: 110,685,478 D1959E unknown Het
Fpr-rs7 A G 17: 20,113,607 I207T probably benign Het
Fubp3 C A 2: 31,598,551 L140I probably damaging Het
Gas2l2 T C 11: 83,427,472 D137G probably damaging Het
Git1 G T 11: 77,506,418 R699L possibly damaging Het
Gnao1 T A 8: 93,963,437 F27L probably benign Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Itga6 T G 2: 71,834,034 Y505D probably damaging Het
Itgad A T 7: 128,183,006 T205S probably benign Het
Jakmip3 A T 7: 139,029,646 Y574F probably benign Het
Laptm5 G T 4: 130,926,209 probably benign Het
Mlana A T 19: 29,706,852 R71S probably benign Het
Mus81 G C 19: 5,485,117 R295G probably benign Het
Ncapd3 T A 9: 27,087,566 probably null Het
Nectin1 A G 9: 43,792,099 E218G possibly damaging Het
Nectin3 A T 16: 46,448,394 Y548* probably null Het
Nif3l1 T C 1: 58,447,943 F96S probably damaging Het
Ntrk1 A G 3: 87,789,611 probably null Het
Obsl1 C A 1: 75,486,784 E1755* probably null Het
Olfr1198 T C 2: 88,746,834 E18G possibly damaging Het
Osbpl9 T C 4: 109,101,156 D74G probably damaging Het
Osgin1 T A 8: 119,443,113 probably null Het
Otogl A G 10: 107,779,252 Y1931H probably benign Het
Pmepa1 A G 2: 173,228,081 I227T probably benign Het
Pprc1 T A 19: 46,063,736 N564K possibly damaging Het
Prkaa1 T C 15: 5,164,744 F92S probably damaging Het
Ptprd A G 4: 76,066,200 F811L probably damaging Het
Rad54b A G 4: 11,606,152 K520R possibly damaging Het
Rbfox1 A G 16: 7,330,433 T269A possibly damaging Het
Rfwd3 T C 8: 111,278,288 Y554C probably damaging Het
Rfx2 A T 17: 56,787,720 V208E probably damaging Het
Rgs22 G T 15: 36,025,793 probably benign Het
Rrbp1 A G 2: 143,955,112 probably null Het
Ryr2 C T 13: 11,714,503 probably benign Het
Sbno1 A G 5: 124,384,460 probably benign Het
Secisbp2 T C 13: 51,679,723 probably benign Het
Sgsm2 C A 11: 74,869,138 R58L probably benign Het
Slc25a36 A C 9: 97,093,073 probably benign Het
Spink4 A G 4: 40,929,121 T49A possibly damaging Het
Steap3 A T 1: 120,227,820 F470I probably damaging Het
Stk10 A G 11: 32,617,919 Q907R probably damaging Het
Tdrd5 A G 1: 156,277,487 V446A probably damaging Het
Tmem117 G A 15: 95,094,597 M379I probably benign Het
Trappc12 A G 12: 28,747,161 L124P possibly damaging Het
Trim9 G A 12: 70,251,093 H613Y probably damaging Het
Trio A G 15: 27,897,914 W371R probably damaging Het
Ulk4 G C 9: 121,266,258 H110D possibly damaging Het
Upb1 T C 10: 75,439,942 V387A probably benign Het
Utrn A T 10: 12,744,049 I284N possibly damaging Het
Vmn2r111 C A 17: 22,571,116 W303L probably benign Het
Vmn2r15 G T 5: 109,294,087 P160Q probably damaging Het
Wdtc1 A G 4: 133,301,807 S323P probably benign Het
Zfp846 T A 9: 20,594,097 C418S possibly damaging Het
Zfyve26 G T 12: 79,252,163 P441Q probably benign Het
Other mutations in Mroh2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Mroh2a APN 1 88230746 missense probably damaging 0.99
IGL00990:Mroh2a APN 1 88244970 missense probably benign 0.03
IGL00990:Mroh2a APN 1 88234120 missense possibly damaging 0.76
IGL03097:Mroh2a UTSW 1 88235376 missense probably benign 0.30
R0032:Mroh2a UTSW 1 88256166 frame shift probably null
R0068:Mroh2a UTSW 1 88256166 frame shift probably null
R0139:Mroh2a UTSW 1 88257802 missense probably damaging 1.00
R0197:Mroh2a UTSW 1 88246042 missense probably damaging 1.00
R0242:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0322:Mroh2a UTSW 1 88230680 nonsense probably null
R0374:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0387:Mroh2a UTSW 1 88246042 missense probably damaging 1.00
R0412:Mroh2a UTSW 1 88235216 missense probably benign 0.01
R0536:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R0548:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0580:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R0581:Mroh2a UTSW 1 88256166 frame shift probably null
R0583:Mroh2a UTSW 1 88256166 frame shift probably null
R0613:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R0652:Mroh2a UTSW 1 88230680 nonsense probably null
R0657:Mroh2a UTSW 1 88255565 missense probably damaging 1.00
R0659:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0659:Mroh2a UTSW 1 88250342 missense probably damaging 1.00
R0671:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0675:Mroh2a UTSW 1 88228380 missense probably damaging 0.99
R0675:Mroh2a UTSW 1 88250342 missense probably damaging 1.00
R0689:Mroh2a UTSW 1 88230680 nonsense probably null
R0689:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R0735:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R0761:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R0766:Mroh2a UTSW 1 88230680 nonsense probably null
R0845:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R0853:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R0959:Mroh2a UTSW 1 88232257 frame shift probably null
R0960:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R1004:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R1013:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R1028:Mroh2a UTSW 1 88235376 missense probably benign 0.30
R1268:Mroh2a UTSW 1 88230680 nonsense probably null
R1281:Mroh2a UTSW 1 88256167 frame shift probably null
R1414:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R1441:Mroh2a UTSW 1 88241631 missense possibly damaging 0.93
R1442:Mroh2a UTSW 1 88232353 splice site probably benign
R1442:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R1465:Mroh2a UTSW 1 88257802 missense probably damaging 1.00
R1662:Mroh2a UTSW 1 88241618 missense probably benign 0.07
R1686:Mroh2a UTSW 1 88230680 nonsense probably null
R1686:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R1780:Mroh2a UTSW 1 88230680 nonsense probably null
R1846:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R1899:Mroh2a UTSW 1 88235376 missense probably benign 0.30
R1958:Mroh2a UTSW 1 88237491 nonsense probably null
R2122:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R2248:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R2306:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R2869:Mroh2a UTSW 1 88232257 frame shift probably null
R2870:Mroh2a UTSW 1 88232257 frame shift probably null
R2871:Mroh2a UTSW 1 88255565 missense probably damaging 1.00
R2872:Mroh2a UTSW 1 88232257 frame shift probably null
R3408:Mroh2a UTSW 1 88232257 frame shift probably null
R3608:Mroh2a UTSW 1 88244995 missense probably damaging 1.00
R3730:Mroh2a UTSW 1 88232257 frame shift probably null
R3937:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4022:Mroh2a UTSW 1 88246042 missense probably damaging 1.00
R4049:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4133:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R4361:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R4392:Mroh2a UTSW 1 88259589 missense probably damaging 1.00
R4401:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R4402:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R4575:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4625:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R4631:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4665:Mroh2a UTSW 1 88241618 missense probably benign 0.07
R4701:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R4701:Mroh2a UTSW 1 88241618 missense probably benign 0.07
R4771:Mroh2a UTSW 1 88251365 missense probably damaging 1.00
R4795:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4839:Mroh2a UTSW 1 88237944 missense probably damaging 1.00
R4873:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R4875:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R4896:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R5007:Mroh2a UTSW 1 88232257 frame shift probably null
R5031:Mroh2a UTSW 1 88232257 frame shift probably null
R5062:Mroh2a UTSW 1 88232257 frame shift probably null
R5301:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5367:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R5371:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5446:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R5484:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5506:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5561:Mroh2a UTSW 1 88232257 frame shift probably null
R5615:Mroh2a UTSW 1 88232257 frame shift probably null
R5825:Mroh2a UTSW 1 88230680 nonsense probably null
R5891:Mroh2a UTSW 1 88241615 missense possibly damaging 0.93
R5906:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5928:Mroh2a UTSW 1 88241618 missense probably benign 0.07
R6004:Mroh2a UTSW 1 88248655 missense probably damaging 1.00
R6035:Mroh2a UTSW 1 88230668 missense probably damaging 1.00
R6064:Mroh2a UTSW 1 88232257 frame shift probably null
R6074:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R6091:Mroh2a UTSW 1 88232257 frame shift probably null
R6127:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R6234:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R6234:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R6244:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R6464:Mroh2a UTSW 1 88257802 missense probably damaging 1.00
R6465:Mroh2a UTSW 1 88232257 frame shift probably null
R6575:Mroh2a UTSW 1 88232257 frame shift probably null
R6809:Mroh2a UTSW 1 88235216 missense probably benign 0.01
R6819:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R6854:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R6860:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R7126:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R7818:Mroh2a UTSW 1 88234612 critical splice donor site probably null
RF024:Mroh2a UTSW 1 88242485 missense probably damaging 1.00
V5622:Mroh2a UTSW 1 88227091 start gained probably benign
V8831:Mroh2a UTSW 1 88256167 frame shift probably null
X0027:Mroh2a UTSW 1 88248613 missense possibly damaging 0.86
X0028:Mroh2a UTSW 1 88232257 frame shift probably null
X0028:Mroh2a UTSW 1 88256166 frame shift probably null
X0033:Mroh2a UTSW 1 88256166 frame shift probably null
X0034:Mroh2a UTSW 1 88232257 frame shift probably null
X0034:Mroh2a UTSW 1 88232292 missense probably damaging 1.00
X0034:Mroh2a UTSW 1 88256166 frame shift probably null
X0039:Mroh2a UTSW 1 88232257 frame shift probably null
X0057:Mroh2a UTSW 1 88232257 frame shift probably null
X0057:Mroh2a UTSW 1 88255655 missense probably benign 0.25
X0057:Mroh2a UTSW 1 88256166 frame shift probably null
X0063:Mroh2a UTSW 1 88232257 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGCGTGCTCAAGTGAATTCCATCC -3'
(R):5'- TCACTGAGCCAGCAGATGCAAG -3'

Sequencing Primer
(F):5'- GAGCTAGAGTCATTATGCCCAGTC -3'
(R):5'- CCAGCAGATGCAAGGTTTC -3'
Posted On2014-11-17