Mutagenetix > Incidental Mutation

Incidental Mutation 'R4701:Mroh2a'

386357

Institutional Source

Beutler Lab

Gene Symbol

Mroh2a

Ensembl Gene

ENSMUSG00000079429

Gene Name

maestro heat-like repeat family member 2A

Synonyms

Heatr7b1, ENSMUSG00000044873, OTTMUSG00000020804

MMRRC Submission

041949-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.934) question?

Stock #

R4701 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

88226986-88262289 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 88241618 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 672 (I672L)

Ref Sequence

ENSEMBL: ENSMUSP00000130508 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061013] [ENSMUST00000113130]

AlphaFold

D3Z750

Predicted Effect

probably benign
Transcript: ENSMUST00000061013
AA Change: I672L

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429
AA Change: I672L

Domain	Start	End	E-Value	Type
low complexity region	9	26	N/A	INTRINSIC
low complexity region	99	112	N/A	INTRINSIC
low complexity region	1235	1248	N/A	INTRINSIC
SCOP:d1jdha_	1371	1669	9e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000113130
AA Change: I669L

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429
AA Change: I669L

Domain	Start	End	E-Value	Type
low complexity region	9	26	N/A	INTRINSIC
low complexity region	99	112	N/A	INTRINSIC
low complexity region	1232	1245	N/A	INTRINSIC
SCOP:d1gw5a_	1446	1671	6e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142632

Meta Mutation Damage Score

0.0778

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.6%

Validation Efficiency

96% (108/112)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a HEAT-domain-containing protein. The function of the encoded protein has not been characterized. [provided by RefSeq, Aug 2016]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aarsd1	T	C	11: 101,411,160	I196V	probably benign	Het
Aass	T	A	6: 23,075,856	K761*	probably null	Het
Abca13	A	G	11: 9,292,306	T1390A	possibly damaging	Het
Abhd16a	T	C	17: 35,096,606		probably null	Het
Acad11	C	T	9: 104,095,565	Q486*	probably null	Het
Actl9	T	C	17: 33,433,935	L323P	probably benign	Het
Adam12	T	A	7: 133,916,462	I650F	possibly damaging	Het
Adgre4	A	T	17: 55,784,971	D77V	probably damaging	Het
Ankrd26	A	G	6: 118,506,485	F1586S	possibly damaging	Het
Anpep	T	C	7: 79,839,465	T320A	probably benign	Het
Arl15	T	A	13: 113,967,725	C133S	probably benign	Het
Ascc3	A	G	10: 50,720,664	N1230S	possibly damaging	Het
Atf4	T	A	15: 80,257,417	I336K	probably damaging	Het
Atp7b	A	T	8: 22,000,121	S1044T	probably benign	Het
Atp8b4	A	G	2: 126,414,293	F249L	probably damaging	Het
AU021092	G	T	16: 5,212,193	N319K	probably benign	Het
Bbs4	A	G	9: 59,323,519	V440A	probably benign	Het
Bpifb4	G	T	2: 153,950,385	G450C	probably damaging	Het
Cadm1	G	A	9: 47,818,822		probably benign	Het
Ccser2	G	A	14: 36,938,697	L500F	probably damaging	Het
Cd22	T	A	7: 30,876,153	I155F	probably damaging	Het
Cdkl4	A	T	17: 80,543,652	V207E	probably damaging	Het
Cfap65	T	C	1: 74,918,908	D947G	probably damaging	Het
Cntn6	T	C	6: 104,804,360	V397A	probably benign	Het
Cpox	T	A	16: 58,677,969	Y388*	probably null	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dda1	T	A	8: 71,473,810	Y58N	probably damaging	Het
Dennd4a	C	T	9: 64,897,357	T1326I	possibly damaging	Het
Eps8l2	A	T	7: 141,357,260	I338F	probably damaging	Het
Fbxo42	A	G	4: 141,199,809	T467A	probably benign	Het
Flt4	T	C	11: 49,626,808	F319S	possibly damaging	Het
Fmn1	A	T	2: 113,584,071	Y895F	possibly damaging	Het
Gm6887	C	A	7: 42,465,093		noncoding transcript	Het
Grid2	A	G	6: 64,665,915	D887G	probably benign	Het
Grm6	C	T	11: 50,863,010	P714S	probably damaging	Het
Gsto2	A	G	19: 47,884,656	I157V	probably benign	Het
Il15ra	A	G	2: 11,718,345		probably null	Het
Impg1	A	G	9: 80,314,400	F713L	probably benign	Het
Jag1	T	A	2: 137,094,456	T373S	probably benign	Het
Kcnh3	T	A	15: 99,241,945	L904Q	probably benign	Het
Kctd19	C	A	8: 105,390,429	G356V	possibly damaging	Het
Kdm5b	T	A	1: 134,606,012		probably benign	Het
Kif1a	T	C	1: 93,078,835	I37V	probably damaging	Het
Lama5	G	A	2: 180,191,696	R1508C	probably damaging	Het
Lamb1	T	A	12: 31,266,848	C65*	probably null	Het
Lingo1	A	G	9: 56,620,258	F349S	probably damaging	Het
Loxl4	G	A	19: 42,607,613	H147Y	probably benign	Het
Lrrn4cl	T	A	19: 8,852,055	N132K	probably damaging	Het
Med17	A	T	9: 15,270,360	H31Q	probably damaging	Het
Med23	A	T	10: 24,893,648	L476F	probably damaging	Het
Mgst1	A	T	6: 138,150,838	D66V	probably damaging	Het
Muc4	A	T	16: 32,755,846		probably benign	Het
Myo18a	C	T	11: 77,817,665	T30M	probably damaging	Het
Ncapg2	G	T	12: 116,440,618	R903L	probably benign	Het
Nme1	A	G	11: 93,965,908	I9T	probably damaging	Het
Nmt2	T	A	2: 3,322,641	I357N	probably benign	Het
Nphp4	T	C	4: 152,496,659	F100S	probably damaging	Het
Oca2	C	A	7: 56,255,002	T72K	probably benign	Het
Olfr1411	C	A	1: 92,597,438	D306E	probably benign	Het
Olfr625-ps1	G	A	7: 103,683,062	V105M	probably damaging	Het
Olfr676	A	T	7: 105,035,591	D131V	probably damaging	Het
Olfr677	A	T	7: 105,056,879	D211V	probably damaging	Het
Olfr871	T	C	9: 20,212,625	I92T	probably damaging	Het
Plce1	A	T	19: 38,725,007	T1240S	probably benign	Het
Plch1	A	T	3: 63,699,496		probably null	Het
Plxna4	T	C	6: 32,516,688	D331G	probably damaging	Het
Ppp1r3a	T	C	6: 14,718,993	T641A	probably benign	Het
Rab32	A	G	10: 10,550,854	L116P	probably benign	Het
Recql4	C	T	15: 76,708,585	C302Y	probably damaging	Het
Rorc	G	C	3: 94,391,710	E391Q	probably null	Het
Saa4	A	T	7: 46,731,627	F24I	possibly damaging	Het
Sall1	T	A	8: 89,031,160	K772M	probably damaging	Het
Sdk1	T	G	5: 142,185,231	L1950V	probably damaging	Het
Sil1	T	C	18: 35,266,896	E352G	probably benign	Het
Slc26a3	C	T	12: 31,447,774	P59L	probably damaging	Het
Smco2	T	C	6: 146,861,942		probably benign	Het
Sppl3	A	G	5: 115,103,313		probably null	Het
St6gal2	T	A	17: 55,496,344	V360D	probably damaging	Het
Stard9	G	A	2: 120,705,713	R345Q	possibly damaging	Het
Susd4	T	A	1: 182,892,061	Y414N	probably damaging	Het
Tenm4	T	C	7: 96,895,349	Y2191H	probably damaging	Het
Tln2	A	G	9: 67,346,527	V754A	probably benign	Het
Tmem132c	T	A	5: 127,564,496		probably benign	Het
Tnn	A	T	1: 160,147,768	S30T	possibly damaging	Het
Trpd52l3	G	T	19: 30,004,495	V217F	probably damaging	Het
Trpm1	G	T	7: 64,243,500	L1033F	probably damaging	Het
Tulp2	A	G	7: 45,517,924	E182G	probably damaging	Het
Ubr4	A	G	4: 139,471,336	K4490R	possibly damaging	Het
Usp17la	A	T	7: 104,860,649	R154*	probably null	Het
Vmn2r17	T	G	5: 109,427,983	M240R	probably damaging	Het
Vmn2r22	T	A	6: 123,650,469	N56I	probably benign	Het
Wdr66	A	G	5: 123,322,613	K1213E	probably benign	Het
Zdhhc21	A	T	4: 82,820,334	I206N	possibly damaging	Het
Zfp148	T	A	16: 33,456,908	D122E	probably benign	Het
Zfp804a	A	T	2: 82,256,582	S252C	probably damaging	Het
Zgrf1	C	T	3: 127,598,704	T1291I	probably benign	Het

Other mutations in Mroh2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Mroh2a	APN	1	88230746	missense	probably damaging	0.99
IGL00990:Mroh2a	APN	1	88244970	missense	probably benign	0.03
IGL00990:Mroh2a	APN	1	88234120	missense	possibly damaging	0.76
IGL03097:Mroh2a	UTSW	1	88235376	missense	probably benign	0.30
R0032:Mroh2a	UTSW	1	88256166	frame shift	probably null
R0068:Mroh2a	UTSW	1	88256166	frame shift	probably null
R0139:Mroh2a	UTSW	1	88257802	missense	probably damaging	1.00
R0197:Mroh2a	UTSW	1	88246042	missense	probably damaging	1.00
R0242:Mroh2a	UTSW	1	88242420	missense	possibly damaging	0.77
R0322:Mroh2a	UTSW	1	88230680	nonsense	probably null
R0374:Mroh2a	UTSW	1	88242420	missense	possibly damaging	0.77
R0387:Mroh2a	UTSW	1	88246042	missense	probably damaging	1.00
R0412:Mroh2a	UTSW	1	88235216	missense	probably benign	0.01
R0536:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R0548:Mroh2a	UTSW	1	88242420	missense	possibly damaging	0.77
R0580:Mroh2a	UTSW	1	88243950	missense	probably damaging	1.00
R0581:Mroh2a	UTSW	1	88256166	frame shift	probably null
R0583:Mroh2a	UTSW	1	88256166	frame shift	probably null
R0613:Mroh2a	UTSW	1	88243950	missense	probably damaging	1.00
R0652:Mroh2a	UTSW	1	88230680	nonsense	probably null
R0657:Mroh2a	UTSW	1	88255565	missense	probably damaging	1.00
R0659:Mroh2a	UTSW	1	88242420	missense	possibly damaging	0.77
R0659:Mroh2a	UTSW	1	88250342	missense	probably damaging	1.00
R0671:Mroh2a	UTSW	1	88242420	missense	possibly damaging	0.77
R0675:Mroh2a	UTSW	1	88228380	missense	probably damaging	0.99
R0675:Mroh2a	UTSW	1	88250342	missense	probably damaging	1.00
R0689:Mroh2a	UTSW	1	88230680	nonsense	probably null
R0689:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R0735:Mroh2a	UTSW	1	88243950	missense	probably damaging	1.00
R0761:Mroh2a	UTSW	1	88243950	missense	probably damaging	1.00
R0766:Mroh2a	UTSW	1	88230680	nonsense	probably null
R0845:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R0853:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R0959:Mroh2a	UTSW	1	88232257	frame shift	probably null
R0960:Mroh2a	UTSW	1	88242420	missense	possibly damaging	0.77
R1004:Mroh2a	UTSW	1	88242420	missense	possibly damaging	0.77
R1013:Mroh2a	UTSW	1	88234612	critical splice donor site	probably null
R1028:Mroh2a	UTSW	1	88235376	missense	probably benign	0.30
R1268:Mroh2a	UTSW	1	88230680	nonsense	probably null
R1281:Mroh2a	UTSW	1	88256167	frame shift	probably null
R1414:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R1439:Mroh2a	UTSW	1	88257802	missense	probably damaging	1.00
R1441:Mroh2a	UTSW	1	88241631	missense	possibly damaging	0.93
R1442:Mroh2a	UTSW	1	88232353	splice site	probably benign
R1442:Mroh2a	UTSW	1	88242420	missense	possibly damaging	0.77
R1465:Mroh2a	UTSW	1	88257802	missense	probably damaging	1.00
R1662:Mroh2a	UTSW	1	88241618	missense	probably benign	0.07
R1686:Mroh2a	UTSW	1	88230680	nonsense	probably null
R1686:Mroh2a	UTSW	1	88234612	critical splice donor site	probably null
R1780:Mroh2a	UTSW	1	88230680	nonsense	probably null
R1846:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R1899:Mroh2a	UTSW	1	88235376	missense	probably benign	0.30
R1958:Mroh2a	UTSW	1	88237491	nonsense	probably null
R2122:Mroh2a	UTSW	1	88256754	missense	probably benign	0.37
R2248:Mroh2a	UTSW	1	88256754	missense	probably benign	0.37
R2306:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R2869:Mroh2a	UTSW	1	88232257	frame shift	probably null
R2870:Mroh2a	UTSW	1	88232257	frame shift	probably null
R2871:Mroh2a	UTSW	1	88255565	missense	probably damaging	1.00
R2872:Mroh2a	UTSW	1	88232257	frame shift	probably null
R3408:Mroh2a	UTSW	1	88232257	frame shift	probably null
R3608:Mroh2a	UTSW	1	88244995	missense	probably damaging	1.00
R3730:Mroh2a	UTSW	1	88232257	frame shift	probably null
R3937:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R4022:Mroh2a	UTSW	1	88246042	missense	probably damaging	1.00
R4049:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R4133:Mroh2a	UTSW	1	88254965	missense	possibly damaging	0.95
R4361:Mroh2a	UTSW	1	88254965	missense	possibly damaging	0.95
R4392:Mroh2a	UTSW	1	88259589	missense	probably damaging	1.00
R4401:Mroh2a	UTSW	1	88254935	missense	possibly damaging	0.72
R4402:Mroh2a	UTSW	1	88254935	missense	possibly damaging	0.72
R4575:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R4625:Mroh2a	UTSW	1	88254965	missense	possibly damaging	0.95
R4631:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R4665:Mroh2a	UTSW	1	88241618	missense	probably benign	0.07
R4701:Mroh2a	UTSW	1	88234612	critical splice donor site	probably null
R4771:Mroh2a	UTSW	1	88251365	missense	probably damaging	1.00
R4795:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R4839:Mroh2a	UTSW	1	88237944	missense	probably damaging	1.00
R4873:Mroh2a	UTSW	1	88254935	missense	possibly damaging	0.72
R4875:Mroh2a	UTSW	1	88254935	missense	possibly damaging	0.72
R4896:Mroh2a	UTSW	1	88256754	missense	probably benign	0.37
R5007:Mroh2a	UTSW	1	88232257	frame shift	probably null
R5031:Mroh2a	UTSW	1	88232257	frame shift	probably null
R5062:Mroh2a	UTSW	1	88232257	frame shift	probably null
R5301:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R5367:Mroh2a	UTSW	1	88254965	missense	possibly damaging	0.95
R5371:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R5446:Mroh2a	UTSW	1	88254965	missense	possibly damaging	0.95
R5484:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R5506:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R5561:Mroh2a	UTSW	1	88232257	frame shift	probably null
R5615:Mroh2a	UTSW	1	88232257	frame shift	probably null
R5825:Mroh2a	UTSW	1	88230680	nonsense	probably null
R5891:Mroh2a	UTSW	1	88241615	missense	possibly damaging	0.93
R5906:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R5928:Mroh2a	UTSW	1	88241618	missense	probably benign	0.07
R6004:Mroh2a	UTSW	1	88248655	missense	probably damaging	1.00
R6035:Mroh2a	UTSW	1	88230668	missense	probably damaging	1.00
R6064:Mroh2a	UTSW	1	88232257	frame shift	probably null
R6074:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R6091:Mroh2a	UTSW	1	88232257	frame shift	probably null
R6127:Mroh2a	UTSW	1	88234612	critical splice donor site	probably null
R6234:Mroh2a	UTSW	1	88234612	critical splice donor site	probably null
R6234:Mroh2a	UTSW	1	88256754	missense	probably benign	0.37
R6244:Mroh2a	UTSW	1	88256754	missense	probably benign	0.37
R6464:Mroh2a	UTSW	1	88257802	missense	probably damaging	1.00
R6465:Mroh2a	UTSW	1	88232257	frame shift	probably null
R6575:Mroh2a	UTSW	1	88232257	frame shift	probably null
R6809:Mroh2a	UTSW	1	88235216	missense	probably benign	0.01
R6819:Mroh2a	UTSW	1	88242420	missense	possibly damaging	0.77
R6854:Mroh2a	UTSW	1	88243950	missense	probably damaging	1.00
R6860:Mroh2a	UTSW	1	88254935	missense	possibly damaging	0.72
R7126:Mroh2a	UTSW	1	88254935	missense	possibly damaging	0.72
R7818:Mroh2a	UTSW	1	88234612	critical splice donor site	probably null
R8350:Mroh2a	UTSW	1	88244083	splice site	probably null
R9414:Mroh2a	UTSW	1	88251374	missense	probably benign	0.26
RF024:Mroh2a	UTSW	1	88242485	missense	probably damaging	1.00
V5622:Mroh2a	UTSW	1	88227091	start gained	probably benign
V8831:Mroh2a	UTSW	1	88256167	frame shift	probably null
X0027:Mroh2a	UTSW	1	88248613	missense	possibly damaging	0.86
X0028:Mroh2a	UTSW	1	88232257	frame shift	probably null
X0028:Mroh2a	UTSW	1	88256166	frame shift	probably null
X0033:Mroh2a	UTSW	1	88256166	frame shift	probably null
X0034:Mroh2a	UTSW	1	88232257	frame shift	probably null
X0034:Mroh2a	UTSW	1	88232292	missense	probably damaging	1.00
X0034:Mroh2a	UTSW	1	88256166	frame shift	probably null
X0039:Mroh2a	UTSW	1	88232257	frame shift	probably null
X0057:Mroh2a	UTSW	1	88232257	frame shift	probably null
X0057:Mroh2a	UTSW	1	88255655	missense	probably benign	0.25
X0057:Mroh2a	UTSW	1	88256166	frame shift	probably null
X0063:Mroh2a	UTSW	1	88232257	frame shift	probably null
Z1188:Mroh2a	UTSW	1	88235216	missense	probably benign	0.01
Z1190:Mroh2a	UTSW	1	88232257	frame shift	probably null
Z1192:Mroh2a	UTSW	1	88235216	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TTAGAGCTCGGTTGGCCATC -3'
(R):5'- TTAGGACACTAAGCAGTCATGGGG -3'

Sequencing Primer
(F):5'- GTTGGCCATCCATCAACTGAATGG -3'
(R):5'- GCCACCTGATCTGATGTGAAAATGTC -3'

Posted On

2016-05-19