Mutagenetix > Incidental Mutation

Incidental Mutation 'R1439:Vmn2r111'

160882

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r111

Ensembl Gene

ENSMUSG00000095093

Gene Name

vomeronasal 2, receptor 111

Synonyms

EG210876

MMRRC Submission

039494-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R1439 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

22547941-22573273 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 22571116 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Leucine at position 303 (W303L)

Ref Sequence

ENSEMBL: ENSMUSP00000090148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092491]

AlphaFold

K7N674

Predicted Effect

probably benign
Transcript: ENSMUST00000092491
AA Change: W303L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: W303L

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	469	2.5e-29	PFAM
Pfam:NCD3G	512	565	1.1e-20	PFAM
Pfam:7tm_3	595	833	5.6e-54	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.8%
3x: 97.8%
10x: 94.4%
20x: 86.3%

Validation Efficiency

100% (72/72)

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agap1	A	G	1: 89,843,186	N499S	probably damaging	Het
AI661453	C	A	17: 47,466,662		probably benign	Het
Akap1	C	A	11: 88,844,751	G362*	probably null	Het
Alkbh1	A	G	12: 87,429,145	V289A	probably damaging	Het
Bnc2	C	T	4: 84,276,068	E1035K	probably benign	Het
C1s2	T	A	6: 124,630,167		probably benign	Het
C530008M17Rik	T	C	5: 76,840,910	V36A	probably damaging	Het
Cabin1	A	G	10: 75,656,806	I1885T	probably damaging	Het
Col22a1	A	G	15: 71,952,377		probably benign	Het
Cpne4	A	T	9: 104,989,632	T248S	probably damaging	Het
Cubn	T	C	2: 13,287,568	N3268S	probably damaging	Het
Ddx10	T	A	9: 53,240,487	K79N	probably damaging	Het
Dennd1a	A	C	2: 38,043,400	L131R	probably damaging	Het
Dnah9	T	C	11: 65,874,132	Y3862C	probably benign	Het
Eif3e	A	G	15: 43,278,428		probably benign	Het
Emsy	T	C	7: 98,600,841		probably benign	Het
Ep400	A	T	5: 110,685,478	D1959E	unknown	Het
Fpr-rs7	A	G	17: 20,113,607	I207T	probably benign	Het
Fubp3	C	A	2: 31,598,551	L140I	probably damaging	Het
Gas2l2	T	C	11: 83,427,472	D137G	probably damaging	Het
Git1	G	T	11: 77,506,418	R699L	possibly damaging	Het
Gnao1	T	A	8: 93,963,437	F27L	probably benign	Het
Hlx	G	T	1: 184,731,987	A52D	probably damaging	Het
Itga6	T	G	2: 71,834,034	Y505D	probably damaging	Het
Itgad	A	T	7: 128,183,006	T205S	probably benign	Het
Jakmip3	A	T	7: 139,029,646	Y574F	probably benign	Het
Laptm5	G	T	4: 130,926,209		probably benign	Het
Mlana	A	T	19: 29,706,852	R71S	probably benign	Het
Mroh2a	G	C	1: 88,257,802	E1510D	probably damaging	Het
Mus81	G	C	19: 5,485,117	R295G	probably benign	Het
Ncapd3	T	A	9: 27,087,566		probably null	Het
Nectin1	A	G	9: 43,792,099	E218G	possibly damaging	Het
Nectin3	A	T	16: 46,448,394	Y548*	probably null	Het
Nif3l1	T	C	1: 58,447,943	F96S	probably damaging	Het
Ntrk1	A	G	3: 87,789,611		probably null	Het
Obsl1	C	A	1: 75,486,784	E1755*	probably null	Het
Olfr1198	T	C	2: 88,746,834	E18G	possibly damaging	Het
Osbpl9	T	C	4: 109,101,156	D74G	probably damaging	Het
Osgin1	T	A	8: 119,443,113		probably null	Het
Otogl	A	G	10: 107,779,252	Y1931H	probably benign	Het
Pmepa1	A	G	2: 173,228,081	I227T	probably benign	Het
Pprc1	T	A	19: 46,063,736	N564K	possibly damaging	Het
Prkaa1	T	C	15: 5,164,744	F92S	probably damaging	Het
Ptprd	A	G	4: 76,066,200	F811L	probably damaging	Het
Rad54b	A	G	4: 11,606,152	K520R	possibly damaging	Het
Rbfox1	A	G	16: 7,330,433	T269A	possibly damaging	Het
Rfwd3	T	C	8: 111,278,288	Y554C	probably damaging	Het
Rfx2	A	T	17: 56,787,720	V208E	probably damaging	Het
Rgs22	G	T	15: 36,025,793		probably benign	Het
Rrbp1	A	G	2: 143,955,112		probably null	Het
Ryr2	C	T	13: 11,714,503		probably benign	Het
Sbno1	A	G	5: 124,384,460		probably benign	Het
Secisbp2	T	C	13: 51,679,723		probably benign	Het
Sgsm2	C	A	11: 74,869,138	R58L	probably benign	Het
Slc25a36	A	C	9: 97,093,073		probably benign	Het
Spink4	A	G	4: 40,929,121	T49A	possibly damaging	Het
Steap3	A	T	1: 120,227,820	F470I	probably damaging	Het
Stk10	A	G	11: 32,617,919	Q907R	probably damaging	Het
Tdrd5	A	G	1: 156,277,487	V446A	probably damaging	Het
Tmem117	G	A	15: 95,094,597	M379I	probably benign	Het
Trappc12	A	G	12: 28,747,161	L124P	possibly damaging	Het
Trim9	G	A	12: 70,251,093	H613Y	probably damaging	Het
Trio	A	G	15: 27,897,914	W371R	probably damaging	Het
Ulk4	G	C	9: 121,266,258	H110D	possibly damaging	Het
Upb1	T	C	10: 75,439,942	V387A	probably benign	Het
Utrn	A	T	10: 12,744,049	I284N	possibly damaging	Het
Vmn2r15	G	T	5: 109,294,087	P160Q	probably damaging	Het
Wdtc1	A	G	4: 133,301,807	S323P	probably benign	Het
Zfp846	T	A	9: 20,594,097	C418S	possibly damaging	Het
Zfyve26	G	T	12: 79,252,163	P441Q	probably benign	Het

Other mutations in Vmn2r111

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00932:Vmn2r111	APN	17	22548753	missense	probably benign	0.00
IGL01306:Vmn2r111	APN	17	22568984	missense	probably damaging	0.99
IGL01309:Vmn2r111	APN	17	22569016	missense	possibly damaging	0.51
IGL01457:Vmn2r111	APN	17	22571985	nonsense	probably null
IGL01465:Vmn2r111	APN	17	22548737	missense	probably benign	0.00
IGL01505:Vmn2r111	APN	17	22548572	missense	probably benign	0.00
IGL01571:Vmn2r111	APN	17	22571392	missense	probably damaging	0.99
IGL01715:Vmn2r111	APN	17	22569073	splice site	probably benign
IGL01962:Vmn2r111	APN	17	22548284	missense	possibly damaging	0.90
IGL02190:Vmn2r111	APN	17	22570773	missense	probably benign	0.00
IGL02496:Vmn2r111	APN	17	22568856	missense	probably benign
IGL02519:Vmn2r111	APN	17	22548339	missense	possibly damaging	0.80
IGL02616:Vmn2r111	APN	17	22571050	missense	possibly damaging	0.67
IGL02641:Vmn2r111	APN	17	22573224	missense	possibly damaging	0.82
IGL02690:Vmn2r111	APN	17	22559042	critical splice donor site	probably null
IGL02698:Vmn2r111	APN	17	22571245	missense	probably damaging	1.00
IGL03017:Vmn2r111	APN	17	22570858	missense	probably damaging	1.00
R0046:Vmn2r111	UTSW	17	22548009	missense	probably benign
R0064:Vmn2r111	UTSW	17	22572072	missense	probably benign	0.00
R0519:Vmn2r111	UTSW	17	22573121	missense	probably benign	0.02
R1467:Vmn2r111	UTSW	17	22571047	missense	probably damaging	0.99
R1467:Vmn2r111	UTSW	17	22571047	missense	probably damaging	0.99
R1636:Vmn2r111	UTSW	17	22571399	missense	probably damaging	1.00
R1647:Vmn2r111	UTSW	17	22569061	missense	probably benign	0.03
R1648:Vmn2r111	UTSW	17	22569061	missense	probably benign	0.03
R1697:Vmn2r111	UTSW	17	22548060	missense	probably benign	0.26
R1996:Vmn2r111	UTSW	17	22548081	missense	probably benign	0.21
R2040:Vmn2r111	UTSW	17	22548414	missense	probably damaging	1.00
R2075:Vmn2r111	UTSW	17	22559062	missense	probably damaging	1.00
R2134:Vmn2r111	UTSW	17	22573104	missense	possibly damaging	0.68
R2357:Vmn2r111	UTSW	17	22559170	splice site	probably benign
R3700:Vmn2r111	UTSW	17	22571161	nonsense	probably null
R3782:Vmn2r111	UTSW	17	22571320	missense	possibly damaging	0.89
R4085:Vmn2r111	UTSW	17	22559115	missense	probably benign	0.00
R4323:Vmn2r111	UTSW	17	22573178	missense	probably benign	0.02
R4900:Vmn2r111	UTSW	17	22548656	missense	possibly damaging	0.94
R5072:Vmn2r111	UTSW	17	22548041	missense	probably damaging	0.99
R5123:Vmn2r111	UTSW	17	22571143	missense	possibly damaging	0.82
R5181:Vmn2r111	UTSW	17	22571020	missense	possibly damaging	0.56
R5357:Vmn2r111	UTSW	17	22548102	nonsense	probably null
R5398:Vmn2r111	UTSW	17	22573271	start codon destroyed	probably null	0.88
R5434:Vmn2r111	UTSW	17	22548489	missense	probably damaging	0.99
R5462:Vmn2r111	UTSW	17	22548257	missense	probably damaging	1.00
R6149:Vmn2r111	UTSW	17	22548815	missense	probably benign	0.00
R6149:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6207:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6281:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6282:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6283:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6307:Vmn2r111	UTSW	17	22573089	missense	probably benign	0.00
R6323:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6325:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6367:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6368:Vmn2r111	UTSW	17	22571908	missense	probably benign	0.38
R6369:Vmn2r111	UTSW	17	22548602	missense	probably damaging	1.00
R6489:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6490:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6546:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6547:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6557:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6654:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6655:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6657:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6659:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6660:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6664:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6798:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6799:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6801:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6893:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6895:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6897:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6922:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6923:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6944:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6945:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7017:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7018:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7024:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7031:Vmn2r111	UTSW	17	22571245	missense	probably damaging	1.00
R7039:Vmn2r111	UTSW	17	22548184	missense	probably damaging	1.00
R7053:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7054:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7055:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7056:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7145:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7146:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7246:Vmn2r111	UTSW	17	22548714	missense	probably damaging	1.00
R7259:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7260:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7327:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7401:Vmn2r111	UTSW	17	22571086	missense	possibly damaging	0.93
R7514:Vmn2r111	UTSW	17	22548399	missense	probably benign	0.05
R7651:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7781:Vmn2r111	UTSW	17	22570733	missense	probably benign	0.17
R7816:Vmn2r111	UTSW	17	22573102	missense	probably damaging	0.97
R7821:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7838:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8078:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8080:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8117:Vmn2r111	UTSW	17	22571488	missense	probably benign	0.12
R8171:Vmn2r111	UTSW	17	22573092	missense	probably benign	0.10
R8195:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8197:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8411:Vmn2r111	UTSW	17	22548581	missense	probably benign	0.03
R8539:Vmn2r111	UTSW	17	22571293	missense	probably benign	0.23
R8540:Vmn2r111	UTSW	17	22559042	critical splice donor site	probably null
R8540:Vmn2r111	UTSW	17	22559043	missense	probably damaging	1.00
R8557:Vmn2r111	UTSW	17	22571929	nonsense	probably null
R8720:Vmn2r111	UTSW	17	22573213	missense	possibly damaging	0.88
R8729:Vmn2r111	UTSW	17	22548258	missense	probably damaging	1.00
R8843:Vmn2r111	UTSW	17	22548030	missense	probably benign	0.00
R9184:Vmn2r111	UTSW	17	22571841	missense	probably benign
R9374:Vmn2r111	UTSW	17	22568878	missense	probably benign	0.17
R9452:Vmn2r111	UTSW	17	22559151	missense	probably damaging	1.00
X0026:Vmn2r111	UTSW	17	22548695	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GCACTTGCTTTGGGCATTTACAGTC -3'
(R):5'- ACAGTGTGCTTTGCCTTTGTCAAC -3'

Sequencing Primer
(F):5'- TTAGATGCTGAGACCTCACAG -3'
(R):5'- TGTCAACATGATTCCAGTCAAC -3'

Posted On

2014-03-14