Incidental Mutation 'R3714:Abcd4'
ID 259809
Institutional Source Beutler Lab
Gene Symbol Abcd4
Ensembl Gene ENSMUSG00000021240
Gene Name ATP-binding cassette, sub-family D (ALD), member 4
Synonyms Pxmp1l, P69r
MMRRC Submission 040707-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.292) question?
Stock # R3714 (G1)
Quality Score 149
Status Not validated
Chromosome 12
Chromosomal Location 84601464-84617413 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 84611759 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 223 (M223I)
Ref Sequence ENSEMBL: ENSMUSP00000152694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021666] [ENSMUST00000221070] [ENSMUST00000222581] [ENSMUST00000223107]
AlphaFold O89016
Predicted Effect probably benign
Transcript: ENSMUST00000021666
AA Change: M227I

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000021666
Gene: ENSMUSG00000021240
AA Change: M227I

DomainStartEndE-ValueType
Pfam:ABC_membrane_2 14 294 5.4e-86 PFAM
AAA 413 604 2.05e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220553
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220952
Predicted Effect probably benign
Transcript: ENSMUST00000221070
Predicted Effect probably benign
Transcript: ENSMUST00000222581
Predicted Effect probably benign
Transcript: ENSMUST00000222889
Predicted Effect probably benign
Transcript: ENSMUST00000223107
AA Change: M223I

PolyPhen 2 Score 0.426 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.5424 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ALD subfamily, which is involved in peroxisomal import of fatty acids and/or fatty acyl-CoAs in the organelle. All known peroxisomal ABC transporters are half transporters which require a partner half transporter molecule to form a functional homodimeric or heterodimeric transporter. The function of this peroxisomal membrane protein is unknown. However, it is speculated that the human protein may function as a heterodimer for another peroxisomal ABC transporter and, therefore, may modify the adrenoleukodystrophy phenotype. It may also play a role in the process of peroxisome biogenesis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Adck5 G A 15: 76,593,938 V229I probably damaging Het
AF366264 T G 8: 13,836,736 I452L probably benign Het
Ankk1 T G 9: 49,421,713 D157A possibly damaging Het
Atp1a2 A G 1: 172,278,984 I817T probably damaging Het
Ccdc87 A G 19: 4,840,259 S260G probably benign Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Cntnap5c C T 17: 57,892,067 Q119* probably null Het
Cpb2 T A 14: 75,283,217 probably null Het
Ddx47 T A 6: 135,019,062 I329K probably damaging Het
Elavl3 G T 9: 22,018,599 D336E probably benign Het
Fam92b C T 8: 120,174,837 R43H probably damaging Het
Fras1 T C 5: 96,645,970 probably null Het
Fuk G T 8: 110,887,259 D723E probably damaging Het
Garem1 T A 18: 21,148,890 E136D probably damaging Het
Haus6 A G 4: 86,602,867 I178T probably benign Het
Igkv3-2 T G 6: 70,698,496 V10G possibly damaging Het
Jrkl A C 9: 13,244,231 I475R possibly damaging Het
Lcmt1 C T 7: 123,404,460 H146Y probably damaging Het
Lipk A G 19: 34,040,429 N289S probably damaging Het
Mb A G 15: 77,017,589 V102A probably benign Het
Mc4r T A 18: 66,859,821 N74Y probably damaging Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Mroh2b A G 15: 4,943,649 I1045V probably benign Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Ndufs7 T C 10: 80,252,421 I14T probably benign Het
Nlrp4b T C 7: 10,714,881 V337A probably benign Het
Npm2 T C 14: 70,652,620 probably null Het
Olfr1240 G A 2: 89,439,383 L299F probably damaging Het
Olfr479 T C 7: 108,055,435 F151S probably damaging Het
Olfr92 A G 17: 37,111,335 Y216H probably damaging Het
Prdm9 T A 17: 15,557,361 K154* probably null Het
Prkch C T 12: 73,775,516 P630S probably damaging Het
Ptprn T C 1: 75,252,767 probably null Het
Rnf31 T A 14: 55,603,394 D884E probably damaging Het
Slc22a27 A T 19: 7,926,450 N107K possibly damaging Het
Spata5 G A 3: 37,433,209 V407I probably benign Het
Tln1 G T 4: 43,540,597 A1468D probably damaging Het
Tmem185b T A 1: 119,527,051 F181I possibly damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Trappc11 T C 8: 47,505,316 probably benign Het
Vmn1r218 A T 13: 23,136,911 N63Y probably damaging Het
Vps37c A G 19: 10,706,268 D18G probably damaging Het
Other mutations in Abcd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02075:Abcd4 APN 12 84608804 critical splice donor site probably null
IGL02103:Abcd4 APN 12 84612364 missense probably benign 0.00
IGL02892:Abcd4 APN 12 84604997 nonsense probably null
R0112:Abcd4 UTSW 12 84612899 splice site probably benign
R0128:Abcd4 UTSW 12 84612352 missense possibly damaging 0.89
R0144:Abcd4 UTSW 12 84605965 critical splice acceptor site probably null
R0866:Abcd4 UTSW 12 84611733 missense probably damaging 1.00
R0942:Abcd4 UTSW 12 84612828 missense probably damaging 0.96
R1770:Abcd4 UTSW 12 84615100 missense probably benign 0.08
R1796:Abcd4 UTSW 12 84615382 missense probably benign 0.09
R2113:Abcd4 UTSW 12 84609016 nonsense probably null
R3713:Abcd4 UTSW 12 84611759 missense probably benign 0.43
R3715:Abcd4 UTSW 12 84611759 missense probably benign 0.43
R5308:Abcd4 UTSW 12 84603293 critical splice donor site probably null
R5572:Abcd4 UTSW 12 84606276 missense probably benign 0.04
R5632:Abcd4 UTSW 12 84617302 missense probably benign 0.00
R5695:Abcd4 UTSW 12 84613971 missense probably damaging 1.00
R6111:Abcd4 UTSW 12 84615114 missense probably damaging 1.00
R6538:Abcd4 UTSW 12 84611761 missense probably benign 0.12
R7035:Abcd4 UTSW 12 84615349 missense probably damaging 1.00
R7139:Abcd4 UTSW 12 84606298 missense probably benign
R7368:Abcd4 UTSW 12 84612865 missense possibly damaging 0.56
R7374:Abcd4 UTSW 12 84606243 nonsense probably null
R7601:Abcd4 UTSW 12 84613945 missense possibly damaging 0.93
R7663:Abcd4 UTSW 12 84606129 missense probably damaging 1.00
R7990:Abcd4 UTSW 12 84604388 splice site probably null
R8286:Abcd4 UTSW 12 84603146 missense probably benign 0.04
R8312:Abcd4 UTSW 12 84615416 missense probably damaging 1.00
R8331:Abcd4 UTSW 12 84603952 missense probably damaging 1.00
R8469:Abcd4 UTSW 12 84612416 missense probably damaging 1.00
R8486:Abcd4 UTSW 12 84603978 missense probably damaging 1.00
R8726:Abcd4 UTSW 12 84604397 splice site probably benign
R9005:Abcd4 UTSW 12 84608582 nonsense probably null
R9412:Abcd4 UTSW 12 84608807 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGAAGTCACCAGCTCCAG -3'
(R):5'- TGAGGTCAGCACTGTTAGTAC -3'

Sequencing Primer
(F):5'- GTCCCCATACCTAAGGACAGGG -3'
(R):5'- CACAGCGTAGACGACAT -3'
Posted On 2015-01-23