Mutagenetix > Incidental Mutations

Incidental Mutation 'R3714:Fuk'

259796

Institutional Source

Beutler Lab

Gene Symbol

Fuk

Ensembl Gene

ENSMUSG00000033703

Gene Name

fucokinase

Synonyms

L-fucose kinase, 1110046B12Rik

MMRRC Submission

040707-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.193) question?

Stock #

R3714 (G1)

Quality Score

183

Status

Not validated

Chromosome

Chromosomal Location

110882456-110902488 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 110887259 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 723 (D723E)

Ref Sequence

ENSEMBL: ENSMUSP00000039271 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041382] [ENSMUST00000212971]

AlphaFold

Q7TMC8

Predicted Effect

probably damaging
Transcript: ENSMUST00000041382
AA Change: D723E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000039271
Gene: ENSMUSG00000033703
AA Change: D723E

Domain	Start	End	E-Value	Type
low complexity region	22	37	N/A	INTRINSIC
Pfam:Fucokinase	94	496	1.7e-101	PFAM
low complexity region	807	821	N/A	INTRINSIC
Pfam:GHMP_kinases_N	827	894	3.6e-9	PFAM
Pfam:GHMP_kinases_C	970	1052	1e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180679

Predicted Effect

probably benign
Transcript: ENSMUST00000212971

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the GHMP (galacto-, homoserine, mevalonate and phosphomevalonate) kinase family and catalyzes the phosphorylation of L-fucose to form beta-L-fucose 1-phosphate. This enzyme catalyzes the first step in the utilization of free L-fucose in glycoprotein and glycolipid synthesis. L-fucose may be important in mediating a number of cell-cell interactions such as blood group antigen recognition, inflammation, and metastatis. While several transcript variants may exist for this gene, the full-length nature of only one has been described to date. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik1	T	C	11: 48,947,976	T595A	possibly damaging	Het
Abcd4	C	T	12: 84,611,759	M223I	probably benign	Het
Adck5	G	A	15: 76,593,938	V229I	probably damaging	Het
AF366264	T	G	8: 13,836,736	I452L	probably benign	Het
Ankk1	T	G	9: 49,421,713	D157A	possibly damaging	Het
Atp1a2	A	G	1: 172,278,984	I817T	probably damaging	Het
Ccdc87	A	G	19: 4,840,259	S260G	probably benign	Het
Cers3	G	T	7: 66,786,075	A261S	probably benign	Het
Cntnap5c	C	T	17: 57,892,067	Q119*	probably null	Het
Cpb2	T	A	14: 75,283,217		probably null	Het
Ddx47	T	A	6: 135,019,062	I329K	probably damaging	Het
Elavl3	G	T	9: 22,018,599	D336E	probably benign	Het
Fam92b	C	T	8: 120,174,837	R43H	probably damaging	Het
Fras1	T	C	5: 96,645,970		probably null	Het
Garem1	T	A	18: 21,148,890	E136D	probably damaging	Het
Haus6	A	G	4: 86,602,867	I178T	probably benign	Het
Igkv3-2	T	G	6: 70,698,496	V10G	possibly damaging	Het
Jrkl	A	C	9: 13,244,231	I475R	possibly damaging	Het
Lcmt1	C	T	7: 123,404,460	H146Y	probably damaging	Het
Lipk	A	G	19: 34,040,429	N289S	probably damaging	Het
Mb	A	G	15: 77,017,589	V102A	probably benign	Het
Mc4r	T	A	18: 66,859,821	N74Y	probably damaging	Het
Mink1	G	T	11: 70,608,950	R773L	possibly damaging	Het
Mroh2b	A	G	15: 4,943,649	I1045V	probably benign	Het
Myo15	A	T	11: 60,479,231	E939V	possibly damaging	Het
Ndufs7	T	C	10: 80,252,421	I14T	probably benign	Het
Nlrp4b	T	C	7: 10,714,881	V337A	probably benign	Het
Npm2	T	C	14: 70,652,620		probably null	Het
Olfr1240	G	A	2: 89,439,383	L299F	probably damaging	Het
Olfr479	T	C	7: 108,055,435	F151S	probably damaging	Het
Olfr92	A	G	17: 37,111,335	Y216H	probably damaging	Het
Prdm9	T	A	17: 15,557,361	K154*	probably null	Het
Prkch	C	T	12: 73,775,516	P630S	probably damaging	Het
Ptprn	T	C	1: 75,252,767		probably null	Het
Rnf31	T	A	14: 55,603,394	D884E	probably damaging	Het
Slc22a27	A	T	19: 7,926,450	N107K	possibly damaging	Het
Spata5	G	A	3: 37,433,209	V407I	probably benign	Het
Tln1	G	T	4: 43,540,597	A1468D	probably damaging	Het
Tmem185b	T	A	1: 119,527,051	F181I	possibly damaging	Het
Tmem63a	G	A	1: 180,963,114	D446N	possibly damaging	Het
Trappc11	T	C	8: 47,505,316		probably benign	Het
Vmn1r218	A	T	13: 23,136,911	N63Y	probably damaging	Het
Vps37c	A	G	19: 10,706,268	D18G	probably damaging	Het

Other mutations in Fuk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01616:Fuk	APN	8	110890476	missense	possibly damaging	0.75
IGL01963:Fuk	APN	8	110893402	missense	probably damaging	1.00
IGL01986:Fuk	APN	8	110883257	missense	probably benign
PIT4283001:Fuk	UTSW	8	110887432	missense	probably benign	0.05
R0008:Fuk	UTSW	8	110884233	splice site	probably benign
R0032:Fuk	UTSW	8	110892103	missense	possibly damaging	0.55
R0032:Fuk	UTSW	8	110892103	missense	possibly damaging	0.55
R0057:Fuk	UTSW	8	110893768	splice site	probably benign
R0057:Fuk	UTSW	8	110893768	splice site	probably benign
R0280:Fuk	UTSW	8	110894748	missense	probably damaging	1.00
R0285:Fuk	UTSW	8	110893717	missense	probably benign	0.08
R0359:Fuk	UTSW	8	110893259	splice site	probably null
R0587:Fuk	UTSW	8	110883325	missense	probably damaging	0.98
R1528:Fuk	UTSW	8	110883241	missense	probably damaging	1.00
R1731:Fuk	UTSW	8	110894823	missense	probably damaging	0.96
R1907:Fuk	UTSW	8	110893378	nonsense	probably null
R2152:Fuk	UTSW	8	110889072	missense	probably benign	0.03
R2154:Fuk	UTSW	8	110889072	missense	probably benign	0.03
R2392:Fuk	UTSW	8	110889724	missense	probably benign
R3037:Fuk	UTSW	8	110894718	splice site	probably null
R3765:Fuk	UTSW	8	110887104	missense	probably benign	0.00
R4307:Fuk	UTSW	8	110892080	nonsense	probably null
R4404:Fuk	UTSW	8	110890301	missense	probably benign	0.03
R4768:Fuk	UTSW	8	110892134	missense	probably benign	0.00
R4998:Fuk	UTSW	8	110887803	missense	probably damaging	0.96
R5009:Fuk	UTSW	8	110887830	missense	probably damaging	0.99
R5253:Fuk	UTSW	8	110883867	missense	possibly damaging	0.90
R6257:Fuk	UTSW	8	110890545	missense	probably benign	0.00
R6430:Fuk	UTSW	8	110884116	missense	probably benign	0.16
R6536:Fuk	UTSW	8	110883879	missense	possibly damaging	0.47
R6599:Fuk	UTSW	8	110893283	splice site	probably null
R6799:Fuk	UTSW	8	110893418	missense	probably benign
R7051:Fuk	UTSW	8	110890339	missense	probably damaging	0.97
R7184:Fuk	UTSW	8	110887156	missense	probably damaging	1.00
R7241:Fuk	UTSW	8	110895897	missense	probably benign
R7448:Fuk	UTSW	8	110890331	missense	possibly damaging	0.93
R8081:Fuk	UTSW	8	110889151	missense	probably benign
R8094:Fuk	UTSW	8	110895972	missense	probably damaging	1.00
R8692:Fuk	UTSW	8	110889090	missense	probably benign	0.06
R9036:Fuk	UTSW	8	110887432	missense	probably benign	0.05
R9172:Fuk	UTSW	8	110883925	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCGGCACACTATCCTCATG -3'
(R):5'- GGCAAGTCTATTCCCAGCTC -3'

Sequencing Primer
(F):5'- ATGGTCATCTCATCCTGCCGAG -3'
(R):5'- GGGGCTCCATGAGACTATCTTC -3'

Posted On

2015-01-23