Mutagenetix > Incidental Mutation

Incidental Mutation 'R0368:Msh4'

30313

Institutional Source

Beutler Lab

Gene Symbol

Msh4

Ensembl Gene

ENSMUSG00000005493

Gene Name

mutS homolog 4

Synonyms

mMsh4, 4930485C04Rik

MMRRC Submission

038574-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.482) question?

Stock #

R0368 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

153857149-153906138 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 153888825 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 113 (Y113F)

Ref Sequence

ENSEMBL: ENSMUSP00000140265 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005630] [ENSMUST00000188338] [ENSMUST00000190449]

AlphaFold

Q99MT2

Predicted Effect

probably damaging
Transcript: ENSMUST00000005630
AA Change: Y307F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000005630
Gene: ENSMUSG00000005493
AA Change: Y307F

Domain	Start	End	E-Value	Type
low complexity region	91	107	N/A	INTRINSIC
Pfam:MutS_II	177	321	2.3e-20	PFAM
MUTSd	352	679	3.77e-37	SMART
MUTSac	695	888	1.6e-81	SMART
Blast:MUTSac	912	956	1e-9	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000188338
AA Change: Y219F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140190
Gene: ENSMUSG00000005493
AA Change: Y219F

Domain	Start	End	E-Value	Type
Pfam:MutS_II	89	233	5.3e-19	PFAM
MUTSd	264	591	9.4e-40	SMART
MUTSac	607	800	4.2e-84	SMART
Blast:MUTSac	808	866	4e-17	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000190449
AA Change: Y113F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140265
Gene: ENSMUSG00000005493
AA Change: Y113F

Domain	Start	End	E-Value	Type
Pfam:MutS_II	1	127	3.3e-15	PFAM
MUTSd	158	485	9.4e-40	SMART
MUTSac	501	694	4.2e-84	SMART
Blast:MUTSac	702	760	5e-17	BLAST

Coding Region Coverage

1x: 99.1%
3x: 98.1%
10x: 95.7%
20x: 90.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNA mismatch repair mutS family. This member is a meiosis-specific protein that is not involved in DNA mismatch correction, but is required for reciprocal recombination and proper segregation of homologous chromosomes at meiosis I. This protein and MSH5 form a heterodimer which binds uniquely to a Holliday Junction and its developmental progenitor, thus provoking ADP-ATP exchange, and stabilizing the interaction between parental chromosomes during meiosis double-stranded break repair. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit male and female sterility associated with failure to undergo pairing during meiosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahnak	A	T	19: 9,008,350	K2333*	probably null	Het
Aox4	C	T	1: 58,213,079	L38F	probably benign	Het
Arhgef15	T	C	11: 68,954,693	E111G	probably damaging	Het
Atp8a2	A	T	14: 59,860,212	I789N	probably damaging	Het
Cdca2	A	G	14: 67,700,347	S286P	possibly damaging	Het
Chrnb1	T	A	11: 69,784,757	K457M	probably damaging	Het
Clec2g	A	G	6: 128,980,261	I61V	possibly damaging	Het
Cyb5r3	G	A	15: 83,158,792	A233V	probably benign	Het
Cyp4a10	T	A	4: 115,525,377	L278*	probably null	Het
Dnmt1	T	C	9: 20,941,757	E56G	probably damaging	Het
Fam160b1	A	G	19: 57,368,578	T34A	possibly damaging	Het
Fam166a	T	A	2: 25,220,673	D164E	probably benign	Het
Fbln5	A	G	12: 101,809,714		probably null	Het
G3bp1	T	C	11: 55,498,626	F383L	probably damaging	Het
Gabrr3	A	G	16: 59,440,596	D289G	probably damaging	Het
Gpr45	T	C	1: 43,033,016	L273P	probably damaging	Het
Hkdc1	T	C	10: 62,411,707	E125G	probably null	Het
Il25	A	G	14: 54,935,174		probably null	Het
Itfg1	A	T	8: 85,764,407	W298R	probably damaging	Het
Kank1	A	T	19: 25,410,603	K547*	probably null	Het
Lama5	G	A	2: 180,181,230	R2748*	probably null	Het
Lrp4	C	T	2: 91,477,734	T508I	probably damaging	Het
Map3k10	C	T	7: 27,663,360	V434I	probably damaging	Het
Map3k6	A	G	4: 133,252,659	M1265V	probably benign	Het
Mocs3	C	T	2: 168,231,682	P350S	probably benign	Het
Naip2	A	C	13: 100,161,782	I582S	probably benign	Het
Nrip1	A	G	16: 76,294,016	S218P	probably damaging	Het
Olfr1281	T	C	2: 111,328,787	Y123H	probably damaging	Het
Olfr1287	T	C	2: 111,449,788	I216T	probably benign	Het
Olig1	C	T	16: 91,270,652	S259F	probably damaging	Het
Osbpl9	A	G	4: 109,066,932	V499A	probably damaging	Het
Pafah2	T	C	4: 134,422,491	V371A	probably benign	Het
Pkp1	T	A	1: 135,875,683	M712L	probably benign	Het
Pkp1	T	C	1: 135,886,852	S244G	probably benign	Het
Ppp1r3a	T	C	6: 14,718,960	T652A	probably benign	Het
Rab21	A	T	10: 115,298,890	V108E	probably damaging	Het
Rab5b	C	T	10: 128,682,903	R120Q	probably benign	Het
Scd2	G	A	19: 44,301,246	V227I	probably benign	Het
Sema5b	T	A	16: 35,628,100	V82E	probably damaging	Het
Sema6a	G	A	18: 47,290,045		probably null	Het
Slc13a2	A	T	11: 78,404,800	L80*	probably null	Het
Slc1a5	C	T	7: 16,782,178	P93L	probably damaging	Het
Slc35b2	T	C	17: 45,566,463	V172A	probably benign	Het
Slfn8	A	G	11: 83,017,132	L195P	probably damaging	Het
Smox	G	A	2: 131,522,158	S320N	probably damaging	Het
Sptan1	T	C	2: 29,993,915	V589A	probably benign	Het
Stim2	G	A	5: 54,110,140		probably null	Het
V1ra8	A	G	6: 90,202,962	D49G	probably damaging	Het
Vmn1r233	A	T	17: 20,994,607	V27D	possibly damaging	Het
Vmn2r98	A	T	17: 19,065,827	K196*	probably null	Het
Wdr77	T	C	3: 105,962,066		probably null	Het

Other mutations in Msh4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00862:Msh4	APN	3	153883735	missense	possibly damaging	0.88
IGL01098:Msh4	APN	3	153877982	splice site	probably benign
IGL01609:Msh4	APN	3	153897397	missense	probably damaging	1.00
IGL01785:Msh4	APN	3	153857507	missense	probably damaging	1.00
IGL01939:Msh4	APN	3	153857589	missense	probably damaging	1.00
IGL02022:Msh4	APN	3	153886956	missense	probably damaging	1.00
IGL02209:Msh4	APN	3	153888862	missense	probably damaging	1.00
IGL02224:Msh4	APN	3	153890185	missense	possibly damaging	0.94
IGL02240:Msh4	APN	3	153873674	missense	probably damaging	0.98
IGL02493:Msh4	APN	3	153877908	critical splice donor site	probably null
IGL02576:Msh4	APN	3	153867746	missense	probably damaging	1.00
IGL02616:Msh4	APN	3	153857523	missense	probably benign
IGL02812:Msh4	APN	3	153901400	splice site	probably benign
IGL02888:Msh4	APN	3	153896913	nonsense	probably null
IGL02992:Msh4	APN	3	153872325	missense	possibly damaging	0.79
IGL03191:Msh4	APN	3	153869608	missense	probably damaging	0.97
P0021:Msh4	UTSW	3	153888818	missense	probably damaging	1.00
R0057:Msh4	UTSW	3	153869681	missense	probably benign	0.16
R0057:Msh4	UTSW	3	153869681	missense	probably benign	0.16
R0377:Msh4	UTSW	3	153896890	missense	probably benign	0.00
R0631:Msh4	UTSW	3	153866420	missense	probably benign	0.02
R0632:Msh4	UTSW	3	153896895	missense	probably damaging	1.00
R0677:Msh4	UTSW	3	153879367	missense	possibly damaging	0.69
R0909:Msh4	UTSW	3	153863504	missense	probably benign	0.00
R1081:Msh4	UTSW	3	153872358	missense	probably benign	0.06
R1463:Msh4	UTSW	3	153857570	missense	probably damaging	1.00
R1476:Msh4	UTSW	3	153863384	missense	probably damaging	1.00
R1669:Msh4	UTSW	3	153876720	missense	possibly damaging	0.47
R1733:Msh4	UTSW	3	153867767	missense	probably damaging	1.00
R1859:Msh4	UTSW	3	153905880	missense	probably benign
R2168:Msh4	UTSW	3	153867835	nonsense	probably null
R2378:Msh4	UTSW	3	153863477	missense	probably damaging	0.99
R2991:Msh4	UTSW	3	153905860	missense	probably benign
R3025:Msh4	UTSW	3	153863491	missense	probably damaging	1.00
R4604:Msh4	UTSW	3	153872283	missense	probably damaging	1.00
R4757:Msh4	UTSW	3	153879387	missense	probably damaging	0.99
R5205:Msh4	UTSW	3	153866412	missense	probably damaging	1.00
R5285:Msh4	UTSW	3	153873713	missense	probably benign	0.03
R5766:Msh4	UTSW	3	153867840	missense	probably damaging	1.00
R5777:Msh4	UTSW	3	153863439	missense	probably benign	0.01
R5888:Msh4	UTSW	3	153867723	critical splice donor site	probably null
R7384:Msh4	UTSW	3	153888748	missense	probably benign	0.23
R7408:Msh4	UTSW	3	153876745	missense	probably benign	0.06
R7487:Msh4	UTSW	3	153863510	missense	probably damaging	1.00
R7503:Msh4	UTSW	3	153867750	missense	probably damaging	1.00
R7726:Msh4	UTSW	3	153866320	critical splice donor site	probably null
R7990:Msh4	UTSW	3	153896892	missense	probably damaging	1.00
R8097:Msh4	UTSW	3	153877908	critical splice donor site	probably null
R8805:Msh4	UTSW	3	153857633	missense	probably benign	0.00
R8814:Msh4	UTSW	3	153872320	missense	probably damaging	1.00
R8861:Msh4	UTSW	3	153901468	missense	probably benign	0.04
R8970:Msh4	UTSW	3	153869732	nonsense	probably null
R9010:Msh4	UTSW	3	153890182	missense	probably benign	0.30
R9338:Msh4	UTSW	3	153867807	missense	possibly damaging	0.55
R9598:Msh4	UTSW	3	153901511	missense	possibly damaging	0.93
R9780:Msh4	UTSW	3	153876705	missense	probably damaging	1.00
Z1177:Msh4	UTSW	3	153879368	missense	probably benign	0.00
Z1177:Msh4	UTSW	3	153901443	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- GACTTCAGAAACAACACGGCGATG -3'
(R):5'- AAGTGACAGACTTCCAAGGCTGC -3'

Sequencing Primer
(F):5'- CAACACGGCGATGATTTAAGTG -3'
(R):5'- tggaaggatgatgctcaagg -3'

Posted On

2013-04-24