Mutagenetix > Incidental Mutation

Incidental Mutation 'R3947:Rbm20'

307770

Institutional Source

Beutler Lab

Gene Symbol

Rbm20

Ensembl Gene

ENSMUSG00000043639

Gene Name

RNA binding motif protein 20

Synonyms

2010003H22Rik, 1110018J23Rik

MMRRC Submission

040927-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.139) question?

Stock #

R3947 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

53677306-53867080 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 53813337 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 92 (I92T)

Ref Sequence

ENSEMBL: ENSMUSP00000129447 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095969] [ENSMUST00000164202]

AlphaFold

Q3UQS8

Predicted Effect

probably benign
Transcript: ENSMUST00000095969
AA Change: I92T

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000093665
Gene: ENSMUSG00000043639
AA Change: I92T

Domain	Start	End	E-Value	Type
low complexity region	25	61	N/A	INTRINSIC
low complexity region	106	117	N/A	INTRINSIC
low complexity region	170	183	N/A	INTRINSIC
low complexity region	251	260	N/A	INTRINSIC
ZnF_C2H2	413	437	4.69e0	SMART
RRM	521	591	4.01e-5	SMART
low complexity region	634	657	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162910

Predicted Effect

probably benign
Transcript: ENSMUST00000164202
AA Change: I92T

PolyPhen 2 Score 0.349 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000129447
Gene: ENSMUSG00000043639
AA Change: I92T

Domain	Start	End	E-Value	Type
low complexity region	25	61	N/A	INTRINSIC
low complexity region	106	117	N/A	INTRINSIC
low complexity region	170	183	N/A	INTRINSIC
low complexity region	251	260	N/A	INTRINSIC
ZnF_U1	410	444	6.79e-1	SMART
ZnF_C2H2	413	437	4.69e0	SMART
RRM	521	591	4.01e-5	SMART
low complexity region	634	657	N/A	INTRINSIC
low complexity region	804	815	N/A	INTRINSIC
low complexity region	833	844	N/A	INTRINSIC
ZnF_U1	1130	1165	7.26e-6	SMART
ZnF_C2H2	1133	1158	3.13e1	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

97% (32/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds RNA and regulates splicing. Mutations in this gene have been associated with familial dilated cardiomyopathy. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for an allele lacking the RNA recognition motif exhibit increased titin compliance, and attenuated Frank-Starling mechanism. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acin1	T	A	14: 54,679,333	Q133L	possibly damaging	Het
Adgrg4	C	T	X: 56,917,754	T1561I	probably benign	Het
Avl9	T	C	6: 56,728,665		probably null	Het
C87436	T	A	6: 86,446,186	H247Q	probably damaging	Het
Cfap43	G	T	19: 47,765,979	H969N	probably benign	Het
Chst15	T	A	7: 132,247,875	N446Y	probably damaging	Het
Col4a3	T	A	1: 82,715,332	I1446N	probably damaging	Het
Disc1	A	G	8: 125,088,135	E246G	probably damaging	Het
Dyrk4	A	G	6: 126,885,305	I408T	probably damaging	Het
Fnbp1l	G	T	3: 122,544,579	A481D	possibly damaging	Het
Gm10608	TACACACACACACACACACACACACACACACACACACACACACACACACACACACA	TACACACACACACACACACACACACACACACACACACACACACACACACA	9: 119,160,662		probably benign	Het
Grk2	G	A	19: 4,292,417	T129M	possibly damaging	Het
Ino80d	G	T	1: 63,074,503	Q263K	probably benign	Het
Iqsec3	A	T	6: 121,387,824	Y835*	probably null	Het
Irak3	T	A	10: 120,170,373	M213L	probably benign	Het
Macf1	T	C	4: 123,380,420	R6388G	probably damaging	Het
Mtnr1a	T	C	8: 45,087,520	Y173H	probably damaging	Het
Myo5b	C	T	18: 74,695,403	R709W	probably damaging	Het
Nebl	A	T	2: 17,378,106		probably null	Het
Obscn	T	C	11: 59,131,646	R758G	possibly damaging	Het
Olfr123	A	T	17: 37,796,115	I224L	probably benign	Het
Pex11g	G	A	8: 3,465,787	T82I	probably benign	Het
Pgr	A	G	9: 8,961,452	I842V	probably benign	Het
Pkd1	T	A	17: 24,578,037		probably benign	Het
Ryr3	C	G	2: 112,675,873	R3443P	probably damaging	Het
Ssh2	A	G	11: 77,398,256	D88G	probably damaging	Het
Suclg2	G	T	6: 95,579,238		probably null	Het
Tdrd3	A	T	14: 87,506,599	D655V	probably damaging	Het
Tex2	C	T	11: 106,520,003	D896N	unknown	Het
Tmem168	C	A	6: 13,583,052	R610L	probably damaging	Het
Ttc17	A	G	2: 94,376,146		probably benign	Het
Vmn2r99	T	C	17: 19,378,990	M312T	probably benign	Het
Wdfy3	T	C	5: 101,870,036	E2546G	probably damaging	Het

Other mutations in Rbm20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Rbm20	APN	19	53843264	missense	probably damaging	1.00
IGL00815:Rbm20	APN	19	53815517	missense	probably damaging	1.00
IGL00845:Rbm20	APN	19	53817949	missense	probably damaging	1.00
IGL01408:Rbm20	APN	19	53851613	missense	possibly damaging	0.95
IGL01663:Rbm20	APN	19	53840995	missense	probably damaging	1.00
IGL01902:Rbm20	APN	19	53840991	missense	probably damaging	0.99
IGL01942:Rbm20	APN	19	53813443	missense	probably damaging	1.00
IGL02964:Rbm20	APN	19	53813702	missense	probably benign	0.02
IGL03326:Rbm20	APN	19	53814000	missense	possibly damaging	0.85
BB001:Rbm20	UTSW	19	53677585	missense	possibly damaging	0.63
BB002:Rbm20	UTSW	19	53813322	missense	probably damaging	0.97
BB011:Rbm20	UTSW	19	53677585	missense	possibly damaging	0.63
BB012:Rbm20	UTSW	19	53813322	missense	probably damaging	0.97
R0326:Rbm20	UTSW	19	53864165	missense	probably damaging	1.00
R0487:Rbm20	UTSW	19	53851195	missense	probably damaging	1.00
R0965:Rbm20	UTSW	19	53859401	missense	probably damaging	1.00
R1435:Rbm20	UTSW	19	53814157	missense	probably benign	0.16
R1914:Rbm20	UTSW	19	53864087	missense	probably damaging	1.00
R1915:Rbm20	UTSW	19	53864087	missense	probably damaging	1.00
R2011:Rbm20	UTSW	19	53859428	missense	probably damaging	1.00
R2012:Rbm20	UTSW	19	53859428	missense	probably damaging	1.00
R2258:Rbm20	UTSW	19	53851741	missense	probably benign
R4305:Rbm20	UTSW	19	53843260	missense	probably damaging	1.00
R4308:Rbm20	UTSW	19	53843260	missense	probably damaging	1.00
R4521:Rbm20	UTSW	19	53817202	missense	probably benign	0.14
R4970:Rbm20	UTSW	19	53851669	missense	probably damaging	0.99
R5266:Rbm20	UTSW	19	53813387	missense	probably damaging	1.00
R5475:Rbm20	UTSW	19	53834705	nonsense	probably null
R5503:Rbm20	UTSW	19	53851354	missense	possibly damaging	0.75
R5995:Rbm20	UTSW	19	53851267	missense	possibly damaging	0.95
R6836:Rbm20	UTSW	19	53814069	missense	probably damaging	0.98
R6947:Rbm20	UTSW	19	53851265	missense	probably damaging	1.00
R7030:Rbm20	UTSW	19	53834766	missense	probably damaging	1.00
R7117:Rbm20	UTSW	19	53851558	missense	possibly damaging	0.92
R7237:Rbm20	UTSW	19	53851499	missense	probably benign	0.04
R7638:Rbm20	UTSW	19	53814333	missense	possibly damaging	0.95
R7792:Rbm20	UTSW	19	53850136	missense	probably benign
R7823:Rbm20	UTSW	19	53843354	missense	probably benign	0.33
R7924:Rbm20	UTSW	19	53677585	missense	possibly damaging	0.63
R7925:Rbm20	UTSW	19	53813322	missense	probably damaging	0.97
R8044:Rbm20	UTSW	19	53817971	missense	probably benign	0.44
R8045:Rbm20	UTSW	19	53817971	missense	probably benign	0.44
R8046:Rbm20	UTSW	19	53817971	missense	probably benign	0.44
R8100:Rbm20	UTSW	19	53851313	missense	possibly damaging	0.85
R8292:Rbm20	UTSW	19	53851499	missense	possibly damaging	0.71
R8366:Rbm20	UTSW	19	53850181	missense	possibly damaging	0.95
R8518:Rbm20	UTSW	19	53851492	missense	probably benign	0.18
R8799:Rbm20	UTSW	19	53832689	missense	probably damaging	1.00
R8873:Rbm20	UTSW	19	53677480	missense	probably benign	0.00
R8886:Rbm20	UTSW	19	53813336	missense	probably benign	0.00
R9194:Rbm20	UTSW	19	53834700	missense	probably damaging	1.00
R9226:Rbm20	UTSW	19	53851214	missense	possibly damaging	0.92
R9765:Rbm20	UTSW	19	53851629	missense	probably benign
R9793:Rbm20	UTSW	19	53864120	missense	probably benign	0.03
R9795:Rbm20	UTSW	19	53864120	missense	probably benign	0.03
RF016:Rbm20	UTSW	19	53813732	missense	probably benign	0.00
Z1177:Rbm20	UTSW	19	53851685	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACCTATGAGGCAGGGTCTTG -3'
(R):5'- CGAAAAGGCGATTGCGGTTG -3'

Sequencing Primer
(F):5'- CCTATGAGGCAGGGTCTTGTTGAC -3'
(R):5'- AACCGAGGCAGCATGCTG -3'

Posted On

2015-04-17