Incidental Mutation 'R3947:Rbm20'
ID307770
Institutional Source Beutler Lab
Gene Symbol Rbm20
Ensembl Gene ENSMUSG00000043639
Gene NameRNA binding motif protein 20
Synonyms2010003H22Rik, 1110018J23Rik
MMRRC Submission 040927-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R3947 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location53677306-53867080 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53813337 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 92 (I92T)
Ref Sequence ENSEMBL: ENSMUSP00000129447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095969] [ENSMUST00000164202]
Predicted Effect probably benign
Transcript: ENSMUST00000095969
AA Change: I92T

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000093665
Gene: ENSMUSG00000043639
AA Change: I92T

DomainStartEndE-ValueType
low complexity region 25 61 N/A INTRINSIC
low complexity region 106 117 N/A INTRINSIC
low complexity region 170 183 N/A INTRINSIC
low complexity region 251 260 N/A INTRINSIC
ZnF_C2H2 413 437 4.69e0 SMART
RRM 521 591 4.01e-5 SMART
low complexity region 634 657 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162910
Predicted Effect probably benign
Transcript: ENSMUST00000164202
AA Change: I92T

PolyPhen 2 Score 0.349 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000129447
Gene: ENSMUSG00000043639
AA Change: I92T

DomainStartEndE-ValueType
low complexity region 25 61 N/A INTRINSIC
low complexity region 106 117 N/A INTRINSIC
low complexity region 170 183 N/A INTRINSIC
low complexity region 251 260 N/A INTRINSIC
ZnF_U1 410 444 6.79e-1 SMART
ZnF_C2H2 413 437 4.69e0 SMART
RRM 521 591 4.01e-5 SMART
low complexity region 634 657 N/A INTRINSIC
low complexity region 804 815 N/A INTRINSIC
low complexity region 833 844 N/A INTRINSIC
ZnF_U1 1130 1165 7.26e-6 SMART
ZnF_C2H2 1133 1158 3.13e1 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds RNA and regulates splicing. Mutations in this gene have been associated with familial dilated cardiomyopathy. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for an allele lacking the RNA recognition motif exhibit increased titin compliance, and attenuated Frank-Starling mechanism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 T A 14: 54,679,333 Q133L possibly damaging Het
Adgrg4 C T X: 56,917,754 T1561I probably benign Het
Avl9 T C 6: 56,728,665 probably null Het
C87436 T A 6: 86,446,186 H247Q probably damaging Het
Cfap43 G T 19: 47,765,979 H969N probably benign Het
Chst15 T A 7: 132,247,875 N446Y probably damaging Het
Col4a3 T A 1: 82,715,332 I1446N probably damaging Het
Disc1 A G 8: 125,088,135 E246G probably damaging Het
Dyrk4 A G 6: 126,885,305 I408T probably damaging Het
Fnbp1l G T 3: 122,544,579 A481D possibly damaging Het
Gm10608 TACACACACACACACACACACACACACACACACACACACACACACACACACACACA TACACACACACACACACACACACACACACACACACACACACACACACACA 9: 119,160,662 probably benign Het
Grk2 G A 19: 4,292,417 T129M possibly damaging Het
Ino80d G T 1: 63,074,503 Q263K probably benign Het
Iqsec3 A T 6: 121,387,824 Y835* probably null Het
Irak3 T A 10: 120,170,373 M213L probably benign Het
Macf1 T C 4: 123,380,420 R6388G probably damaging Het
Mtnr1a T C 8: 45,087,520 Y173H probably damaging Het
Myo5b C T 18: 74,695,403 R709W probably damaging Het
Nebl A T 2: 17,378,106 probably null Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr123 A T 17: 37,796,115 I224L probably benign Het
Pex11g G A 8: 3,465,787 T82I probably benign Het
Pgr A G 9: 8,961,452 I842V probably benign Het
Pkd1 T A 17: 24,578,037 probably benign Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Ssh2 A G 11: 77,398,256 D88G probably damaging Het
Suclg2 G T 6: 95,579,238 probably null Het
Tdrd3 A T 14: 87,506,599 D655V probably damaging Het
Tex2 C T 11: 106,520,003 D896N unknown Het
Tmem168 C A 6: 13,583,052 R610L probably damaging Het
Ttc17 A G 2: 94,376,146 probably benign Het
Vmn2r99 T C 17: 19,378,990 M312T probably benign Het
Wdfy3 T C 5: 101,870,036 E2546G probably damaging Het
Other mutations in Rbm20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Rbm20 APN 19 53843264 missense probably damaging 1.00
IGL00815:Rbm20 APN 19 53815517 missense probably damaging 1.00
IGL00845:Rbm20 APN 19 53817949 missense probably damaging 1.00
IGL01408:Rbm20 APN 19 53851613 missense possibly damaging 0.95
IGL01663:Rbm20 APN 19 53840995 missense probably damaging 1.00
IGL01902:Rbm20 APN 19 53840991 missense probably damaging 0.99
IGL01942:Rbm20 APN 19 53813443 missense probably damaging 1.00
IGL02964:Rbm20 APN 19 53813702 missense probably benign 0.02
IGL03326:Rbm20 APN 19 53814000 missense possibly damaging 0.85
BB001:Rbm20 UTSW 19 53677585 missense possibly damaging 0.63
BB002:Rbm20 UTSW 19 53813322 missense probably damaging 0.97
BB011:Rbm20 UTSW 19 53677585 missense possibly damaging 0.63
BB012:Rbm20 UTSW 19 53813322 missense probably damaging 0.97
R0326:Rbm20 UTSW 19 53864165 missense probably damaging 1.00
R0487:Rbm20 UTSW 19 53851195 missense probably damaging 1.00
R0965:Rbm20 UTSW 19 53859401 missense probably damaging 1.00
R1435:Rbm20 UTSW 19 53814157 missense probably benign 0.16
R1914:Rbm20 UTSW 19 53864087 missense probably damaging 1.00
R1915:Rbm20 UTSW 19 53864087 missense probably damaging 1.00
R2011:Rbm20 UTSW 19 53859428 missense probably damaging 1.00
R2012:Rbm20 UTSW 19 53859428 missense probably damaging 1.00
R2258:Rbm20 UTSW 19 53851741 missense probably benign
R4305:Rbm20 UTSW 19 53843260 missense probably damaging 1.00
R4308:Rbm20 UTSW 19 53843260 missense probably damaging 1.00
R4521:Rbm20 UTSW 19 53817202 missense probably benign 0.14
R4970:Rbm20 UTSW 19 53851669 missense probably damaging 0.99
R5266:Rbm20 UTSW 19 53813387 missense probably damaging 1.00
R5475:Rbm20 UTSW 19 53834705 nonsense probably null
R5503:Rbm20 UTSW 19 53851354 missense possibly damaging 0.75
R5995:Rbm20 UTSW 19 53851267 missense possibly damaging 0.95
R6836:Rbm20 UTSW 19 53814069 missense probably damaging 0.98
R6947:Rbm20 UTSW 19 53851265 missense probably damaging 1.00
R7030:Rbm20 UTSW 19 53834766 missense probably damaging 1.00
R7117:Rbm20 UTSW 19 53851558 missense possibly damaging 0.92
R7237:Rbm20 UTSW 19 53851499 missense probably benign 0.04
R7638:Rbm20 UTSW 19 53814333 missense possibly damaging 0.95
R7792:Rbm20 UTSW 19 53850136 missense probably benign
R7823:Rbm20 UTSW 19 53843354 missense probably benign 0.33
R7924:Rbm20 UTSW 19 53677585 missense possibly damaging 0.63
R7925:Rbm20 UTSW 19 53813322 missense probably damaging 0.97
R8044:Rbm20 UTSW 19 53817971 missense probably benign 0.44
R8045:Rbm20 UTSW 19 53817971 missense probably benign 0.44
R8046:Rbm20 UTSW 19 53817971 missense probably benign 0.44
R8100:Rbm20 UTSW 19 53851313 missense possibly damaging 0.85
R8292:Rbm20 UTSW 19 53851499 missense possibly damaging 0.71
R8366:Rbm20 UTSW 19 53850181 missense possibly damaging 0.95
R8518:Rbm20 UTSW 19 53851492 missense probably benign 0.18
RF016:Rbm20 UTSW 19 53813732 missense probably benign 0.00
Z1177:Rbm20 UTSW 19 53851685 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCTATGAGGCAGGGTCTTG -3'
(R):5'- CGAAAAGGCGATTGCGGTTG -3'

Sequencing Primer
(F):5'- CCTATGAGGCAGGGTCTTGTTGAC -3'
(R):5'- AACCGAGGCAGCATGCTG -3'
Posted On2015-04-17