Mutagenetix > Incidental Mutations

Incidental Mutation 'R3916:Heatr3'

309746

Institutional Source

Beutler Lab

Gene Symbol

Heatr3

Ensembl Gene

ENSMUSG00000031657

Gene Name

HEAT repeat containing 3

Synonyms

C030036P15Rik

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.941) question?

Stock #

R3916 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

88137855-88172027 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to G at 88150371 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000112812 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034079] [ENSMUST00000121949]

Predicted Effect

probably null
Transcript: ENSMUST00000034079

SMART Domains

Protein: ENSMUSP00000034079
Gene: ENSMUSG00000031657

Domain	Start	End	E-Value	Type
Pfam:HEAT_EZ	41	106	2.5e-11	PFAM
Blast:ARM	111	171	2e-25	BLAST
Blast:ARM	172	215	1e-15	BLAST
low complexity region	357	366	N/A	INTRINSIC
low complexity region	375	393	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000121949

SMART Domains

Protein: ENSMUSP00000112812
Gene: ENSMUSG00000031657

Domain	Start	End	E-Value	Type
Blast:ARM	1	54	7e-20	BLAST
Blast:ARM	55	98	8e-16	BLAST
low complexity region	240	249	N/A	INTRINSIC
low complexity region	258	276	N/A	INTRINSIC

Meta Mutation Damage Score

0.9494

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene plays a role in ribosomal protein transport and in the assembly of the 5S ribonucleoprotein particle (5S RNP). The encoded protein also may be involved in NOD2-mediated NF-kappaB signaling. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	T	G	2: 68,731,985	F319V	possibly damaging	Het
Acad12	A	G	5: 121,599,214	V498A	probably damaging	Het
Adam19	A	G	11: 46,060,935	E37G	probably benign	Het
Anks3	A	G	16: 4,947,279	Y423H	probably damaging	Het
Arfgef1	A	T	1: 10,189,443	V600D	probably benign	Het
Arhgef18	T	C	8: 3,454,197	F939L	probably benign	Het
Arhgef2	A	G	3: 88,633,033	N127S	probably damaging	Het
Arid1b	A	G	17: 5,342,653	S2100G	probably benign	Het
Atp1b2	A	G	11: 69,603,075	V93A	probably damaging	Het
Atrnl1	T	C	19: 57,935,652	V1283A	possibly damaging	Het
Bpifb5	A	C	2: 154,228,181	K184Q	probably benign	Het
Cadps	C	T	14: 12,457,702	A1060T	probably benign	Het
Cant1	A	G	11: 118,408,746	V259A	probably damaging	Het
Ccdc89	A	G	7: 90,426,825	D81G	probably damaging	Het
Cd109	CATTTATTTATTTATTTATTTATTTATTTATTTAT	CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT	9: 78,712,500		probably benign	Het
Cntnap4	C	G	8: 112,875,533	P1190A	probably benign	Het
Colgalt2	T	A	1: 152,508,611	Y567*	probably null	Het
Cyp4f18	A	T	8: 71,996,037	F256Y	probably benign	Het
Ddx41	G	A	13: 55,534,480	R205W	possibly damaging	Het
Dopey1	G	A	9: 86,521,133	R1462H	probably damaging	Het
Dync1i2	A	G	2: 71,249,372	T377A	probably damaging	Het
F2	G	A	2: 91,625,488	T600M	probably damaging	Het
Fam91a1	C	T	15: 58,430,734	H308Y	probably damaging	Het
Fkbp2	C	A	19: 6,978,557		probably null	Het
Gabarapl2	T	A	8: 111,952,396	F115L	probably benign	Het
Ifi204	T	G	1: 173,755,775	K292N	possibly damaging	Het
Itpkc	A	T	7: 27,228,303	I62N	probably benign	Het
Kcnab1	G	A	3: 65,304,164		probably null	Het
Krt88	G	A	15: 101,452,928		probably null	Het
Larp4	C	T	15: 99,990,403	T107I	probably benign	Het
Lmo7	T	C	14: 101,929,342		probably benign	Het
Lrrc37a	T	C	11: 103,455,518	Y3174C	possibly damaging	Het
Lyzl4	T	A	9: 121,583,035	D105V	probably damaging	Het
Mst1	A	G	9: 108,084,295	I575V	probably benign	Het
Myh7	C	A	14: 54,974,046	E1555D	probably damaging	Het
Nwd1	T	A	8: 72,667,811	C608*	probably null	Het
Obox3	C	A	7: 15,627,226	C38F	probably benign	Het
P4ha2	A	G	11: 54,126,248	D441G	probably benign	Het
Pcdhb14	A	T	18: 37,448,545	I235F	possibly damaging	Het
Rasgrf2	A	G	13: 92,030,788	V259A	probably damaging	Het
Scn1a	T	C	2: 66,277,613	T1590A	probably damaging	Het
Sdk1	T	A	5: 142,051,244	D817E	probably damaging	Het
Sema3b	A	G	9: 107,600,458	F482S	probably damaging	Het
Slc35a5	G	C	16: 45,158,158		probably benign	Het
Slc6a3	A	G	13: 73,562,308	I346V	probably benign	Het
Slu7	G	T	11: 43,440,684		probably null	Het
Spns1	A	T	7: 126,371,539		probably null	Het
Supv3l1	T	C	10: 62,449,420	D89G	possibly damaging	Het
Taf1c	G	A	8: 119,600,505	R412W	probably damaging	Het
Tctn3	T	A	19: 40,607,649	T305S	possibly damaging	Het
Tekt1	A	G	11: 72,345,748	I296T	possibly damaging	Het
Tet2	T	C	3: 133,486,055	K873E	possibly damaging	Het
Thada	G	A	17: 84,441,782	A587V	possibly damaging	Het
Tmprss15	T	A	16: 78,985,996	N712Y	probably damaging	Het
Tnks	A	G	8: 34,853,361	S719P	probably damaging	Het
Tnrc6a	A	C	7: 123,181,384	Q1332H	probably damaging	Het
Trpv3	A	G	11: 73,283,734	D309G	possibly damaging	Het
Tti2	A	G	8: 31,153,519	K221E	possibly damaging	Het
Uba5	A	T	9: 104,054,190	C227S	probably damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Unc80	T	C	1: 66,677,495	C2925R	probably benign	Het
Vmn2r83	G	A	10: 79,478,910	G331R	probably benign	Het
Xirp2	G	T	2: 67,511,422	V1336F	probably benign	Het
Zbed5	T	C	5: 129,902,277	Y356H	possibly damaging	Het

Other mutations in Heatr3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00544:Heatr3	APN	8	88141739	missense	possibly damaging	0.95
IGL00780:Heatr3	APN	8	88170940	missense	probably benign	0.01
IGL01105:Heatr3	APN	8	88161893	missense	probably benign	0.04
IGL01653:Heatr3	APN	8	88144617	missense	probably benign
IGL02129:Heatr3	APN	8	88158271	splice site	probably benign
IGL02145:Heatr3	APN	8	88144599	missense	probably benign	0.40
IGL02177:Heatr3	APN	8	88156723	missense	probably benign
IGL02309:Heatr3	APN	8	88167072	missense	probably damaging	1.00
IGL02675:Heatr3	APN	8	88144557	missense	possibly damaging	0.91
IGL03379:Heatr3	APN	8	88150110	missense	probably benign	0.13
R0763:Heatr3	UTSW	8	88158241	missense	probably damaging	1.00
R1244:Heatr3	UTSW	8	88141739	missense	possibly damaging	0.95
R1883:Heatr3	UTSW	8	88144593	missense	possibly damaging	0.95
R1988:Heatr3	UTSW	8	88150317	missense	probably benign	0.02
R2043:Heatr3	UTSW	8	88147694	splice site	probably benign
R2079:Heatr3	UTSW	8	88141776	missense	probably damaging	0.99
R2402:Heatr3	UTSW	8	88144572	missense	probably benign	0.33
R3917:Heatr3	UTSW	8	88150371	critical splice donor site	probably null
R4127:Heatr3	UTSW	8	88138311	missense	probably damaging	0.99
R4182:Heatr3	UTSW	8	88171002	utr 3 prime	probably benign
R4190:Heatr3	UTSW	8	88138260	unclassified	probably benign
R4769:Heatr3	UTSW	8	88141783	critical splice donor site	probably null
R6046:Heatr3	UTSW	8	88139954	missense	probably damaging	1.00
R6073:Heatr3	UTSW	8	88138140	missense	probably benign	0.01
R6888:Heatr3	UTSW	8	88170884	missense	probably damaging	1.00
R7284:Heatr3	UTSW	8	88156774	missense	possibly damaging	0.69
R8278:Heatr3	UTSW	8	88156733	missense	possibly damaging	0.50
RF025:Heatr3	UTSW	8	88156456	critical splice acceptor site	probably benign
RF031:Heatr3	UTSW	8	88156457	critical splice acceptor site	probably benign
RF033:Heatr3	UTSW	8	88156456	critical splice acceptor site	probably benign
RF040:Heatr3	UTSW	8	88156457	critical splice acceptor site	probably benign

Predicted Primers

PCR Primer
(F):5'- TGGTCATTCAGATGAAGGAAGCTG -3'
(R):5'- GCTAAGGAAGCCTGCTGAAG -3'

Sequencing Primer
(F):5'- TCATTCAGATGAAGGAAGCTGAAACC -3'
(R):5'- TAACAGTTAAGAGGGCTGATGGTTC -3'

Posted On

2015-04-17