Incidental Mutation 'R4197:Scel'
ID 318611
Institutional Source Beutler Lab
Gene Symbol Scel
Ensembl Gene ENSMUSG00000022123
Gene Name sciellin
Synonyms 9230114I02Rik
MMRRC Submission 041028-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4197 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 103513342-103612797 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 103599400 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Tyrosine at position 475 (N475Y)
Ref Sequence ENSEMBL: ENSMUSP00000154402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095576] [ENSMUST00000227322]
AlphaFold Q9EQG3
Predicted Effect probably damaging
Transcript: ENSMUST00000095576
AA Change: N495Y

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000093233
Gene: ENSMUSG00000022123
AA Change: N495Y

DomainStartEndE-ValueType
low complexity region 111 131 N/A INTRINSIC
low complexity region 159 178 N/A INTRINSIC
internal_repeat_1 204 327 9.24e-7 PROSPERO
internal_repeat_1 378 505 9.24e-7 PROSPERO
low complexity region 525 537 N/A INTRINSIC
LIM 584 642 2.23e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000227322
AA Change: N475Y

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.0796 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a precursor to the cornified envelope of terminally differentiated keratinocytes. This protein localizes to the periphery of cells and may function in the assembly or regulation of proteins in the cornified envelope. Transcript variants encoding different isoforms exist. A transcript variant utilizing an alternative polyA signal has been described in the literature, but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with normal hair morphology and development and normal skin morphology and barrier function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik G A 11: 103,201,140 S94L probably benign Het
BC049730 A G 7: 24,713,694 D146G probably benign Het
Ccno G A 13: 112,989,069 C189Y probably damaging Het
Cd36 T A 5: 17,813,088 D209V probably damaging Het
Depdc5 T A 5: 32,991,203 L1561Q possibly damaging Het
Dhx34 G T 7: 16,203,726 H777N probably damaging Het
Dlat T C 9: 50,636,526 T610A probably damaging Het
Fip1l1 T A 5: 74,535,736 D19E probably damaging Het
Gm5699 T A 1: 30,998,645 noncoding transcript Het
Grin2a A C 16: 9,761,967 F144C probably damaging Het
Klhl18 A T 9: 110,429,944 probably null Het
Klhl31 T C 9: 77,650,809 V269A probably damaging Het
Mmel1 T C 4: 154,893,304 I594T probably damaging Het
Myo9a T A 9: 59,894,866 S1913T probably benign Het
Olfr2 T C 7: 107,001,038 D274G probably damaging Het
Pcdhb14 A G 18: 37,448,305 K155E probably benign Het
Pdcd10 A T 3: 75,517,592 N189K possibly damaging Het
Pde3b T G 7: 114,530,872 probably benign Het
Plxnb2 T C 15: 89,157,018 N1775S probably damaging Het
Polr2a T C 11: 69,735,336 S1625G unknown Het
Ptpn21 G T 12: 98,680,138 H1020Q probably damaging Het
Rad23b C T 4: 55,385,455 P331S probably damaging Het
Sema5a A G 15: 32,618,918 T531A probably benign Het
Sf3b3 A T 8: 110,821,565 L679Q probably damaging Het
Sipa1l3 A T 7: 29,400,813 D10E possibly damaging Het
Slc44a4 G A 17: 34,918,252 V84I probably benign Het
Slco5a1 G T 1: 12,894,516 S512R probably damaging Het
Sv2c A T 13: 95,978,128 F517I probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tnfsf11 A T 14: 78,284,312 D152E probably benign Het
Trav13n-4 C T 14: 53,363,921 T49I probably benign Het
Ttn T C 2: 76,886,078 probably benign Het
Usp34 T C 11: 23,444,189 S2261P probably damaging Het
Vmn2r87 G A 10: 130,479,910 P96S possibly damaging Het
Xrcc6 A G 15: 82,029,224 M353V probably benign Het
Other mutations in Scel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Scel APN 14 103529995 missense probably benign 0.01
IGL00913:Scel APN 14 103581809 missense probably benign 0.35
IGL01086:Scel APN 14 103612391 missense probably benign 0.05
IGL01352:Scel APN 14 103533338 missense possibly damaging 0.54
IGL01396:Scel APN 14 103608094 splice site probably benign
IGL01954:Scel APN 14 103603242 splice site probably benign
IGL02064:Scel APN 14 103533326 missense probably damaging 0.98
IGL02186:Scel APN 14 103564821 missense probably benign 0.23
IGL02475:Scel APN 14 103537008 missense possibly damaging 0.95
IGL02926:Scel APN 14 103576247 nonsense probably null
IGL03122:Scel APN 14 103599406 missense possibly damaging 0.66
IGL03135:Scel APN 14 103586514 missense probably benign 0.02
PIT4585001:Scel UTSW 14 103592368 missense possibly damaging 0.90
R0346:Scel UTSW 14 103529984 missense probably damaging 1.00
R0394:Scel UTSW 14 103562518 missense probably benign 0.15
R0418:Scel UTSW 14 103603254 missense probably benign
R0635:Scel UTSW 14 103583139 critical splice donor site probably null
R0815:Scel UTSW 14 103586480 missense possibly damaging 0.83
R0863:Scel UTSW 14 103586480 missense possibly damaging 0.83
R0990:Scel UTSW 14 103581832 missense possibly damaging 0.55
R1084:Scel UTSW 14 103564843 critical splice donor site probably null
R1641:Scel UTSW 14 103533316 missense probably damaging 1.00
R2001:Scel UTSW 14 103610790 missense possibly damaging 0.66
R2002:Scel UTSW 14 103541985 missense probably damaging 1.00
R2341:Scel UTSW 14 103608170 missense possibly damaging 0.92
R3425:Scel UTSW 14 103608106 missense possibly damaging 0.92
R3836:Scel UTSW 14 103592386 missense possibly damaging 0.66
R4035:Scel UTSW 14 103530004 missense probably damaging 1.00
R4737:Scel UTSW 14 103572037 missense possibly damaging 0.79
R4801:Scel UTSW 14 103583100 missense probably benign 0.01
R4802:Scel UTSW 14 103583100 missense probably benign 0.01
R5369:Scel UTSW 14 103586493 missense probably benign 0.00
R5555:Scel UTSW 14 103602206 missense probably benign 0.27
R5582:Scel UTSW 14 103583139 critical splice donor site probably benign
R5931:Scel UTSW 14 103605624 nonsense probably null
R5978:Scel UTSW 14 103529254 splice site probably null
R6045:Scel UTSW 14 103592213 missense probably benign 0.12
R6062:Scel UTSW 14 103585136 missense possibly damaging 0.82
R6218:Scel UTSW 14 103572042 missense probably benign 0.12
R6225:Scel UTSW 14 103591984 missense probably benign 0.27
R7102:Scel UTSW 14 103543832 nonsense probably null
R7349:Scel UTSW 14 103543879 missense probably benign 0.11
R8376:Scel UTSW 14 103572015 missense probably benign 0.02
R8924:Scel UTSW 14 103592371 missense possibly damaging 0.66
R9014:Scel UTSW 14 103585139 missense probably benign
R9130:Scel UTSW 14 103533310 missense probably benign 0.05
R9135:Scel UTSW 14 103602190 missense probably benign
R9179:Scel UTSW 14 103574400 missense possibly damaging 0.79
R9614:Scel UTSW 14 103605596 missense probably damaging 1.00
R9638:Scel UTSW 14 103541973 missense possibly damaging 0.89
R9672:Scel UTSW 14 103599402 missense possibly damaging 0.82
R9719:Scel UTSW 14 103572006 critical splice acceptor site probably null
X0026:Scel UTSW 14 103591993 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TCAAACCCAGGATTGCCAAG -3'
(R):5'- TATACCAAGTAACAGGACTGAGC -3'

Sequencing Primer
(F):5'- GGATTGCCAAGCATGCTATC -3'
(R):5'- GGGCAGTGTGCATATTTA -3'
Posted On 2015-06-10