Mutagenetix > Incidental Mutations

Incidental Mutation 'R4447:Galnt2'

328804

Institutional Source

Beutler Lab

Gene Symbol

Galnt2

Ensembl Gene

ENSMUSG00000089704

Gene Name

polypeptide N-acetylgalactosaminyltransferase 2

Synonyms

ppGaNTase-T2

MMRRC Submission

041708-MU

Accession Numbers

Ncbi RefSeq: NM_139272.2; MGI:894694

Is this an essential gene?

Probably non essential (E-score: 0.170) question?

Stock #

R4447 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

124231391-124345724 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 124295377 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 14 (D14G)

Ref Sequence

ENSEMBL: ENSMUSP00000118564 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034458] [ENSMUST00000127664]

Predicted Effect

probably benign
Transcript: ENSMUST00000034458
AA Change: D48G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000034458
Gene: ENSMUSG00000089704
AA Change: D48G

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	25	39	N/A	INTRINSIC
Pfam:Glycos_transf_2	138	321	8.3e-31	PFAM
Pfam:Glyco_transf_7C	295	365	5.4e-8	PFAM
RICIN	440	565	9.28e-27	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000127664
AA Change: D14G

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329
AA Change: D14G

Domain	Start	End	E-Value	Type
Pfam:Glycos_transf_2	104	287	7.4e-31	PFAM
Pfam:Glyco_transf_7C	261	331	4.9e-8	PFAM
RICIN	406	531	9.28e-27	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142547

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142578

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147911

Meta Mutation Damage Score

0.0842

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

100% (32/32)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glycosyltransferase 2 protein family. Members of this family initiate mucin-type O-glycoslation of peptides in the Golgi apparatus. The encoded protein may be involved in O-linked glycosylation of the immunoglobulin A1 hinge region. This gene may influence triglyceride levels, and may be involved Type 2 diabetes, as well as several types of cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]

Allele List at MGI

None

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	C	13: 59,742,198	T603A	probably benign	Het
3930402G23Rik	T	A	8: 10,926,129		noncoding transcript	Het
Acsf2	G	T	11: 94,569,359	P389Q	possibly damaging	Het
Aldh6a1	A	G	12: 84,439,709	V120A	possibly damaging	Het
Alg11	C	A	8: 22,068,079	A469E	probably benign	Het
Ankar	A	G	1: 72,687,789	S415P	possibly damaging	Het
Ano3	A	T	2: 110,761,578		probably null	Het
Asic4	A	T	1: 75,470,370		probably benign	Het
Atp1a4	A	C	1: 172,234,431	I709S	probably damaging	Het
Cyp11b2	T	C	15: 74,855,563	I90V	probably benign	Het
Fam129a	A	T	1: 151,636,402		probably null	Het
Iqcm	T	C	8: 75,629,766	S176P	probably damaging	Het
Irf5	T	A	6: 29,535,942	D318E	probably damaging	Het
Map2k3	A	T	11: 60,947,171	S253C	probably damaging	Het
Mgst1	G	T	6: 138,141,664		probably benign	Het
Mipol1	G	T	12: 57,352,748		probably benign	Het
Olfr371	T	A	8: 85,231,366	Y290*	probably null	Het
Pomgnt1	G	T	4: 116,152,923	V161L	possibly damaging	Het
Rnpc3	T	C	3: 113,611,137		probably benign	Het
Rxfp1	C	T	3: 79,652,127		probably benign	Het
Scn5a	T	C	9: 119,550,627	D197G	probably damaging	Het
Thsd7a	G	A	6: 12,324,635	T1479I	probably damaging	Het
Twsg1	C	T	17: 65,929,787	D83N	possibly damaging	Het
Ubqln3	C	T	7: 104,142,814	R23Q	probably benign	Het
Vmn1r228	T	C	17: 20,777,107	I50V	probably damaging	Het
Wnk4	T	A	11: 101,268,451	S565T	possibly damaging	Het
Wwc2	A	G	8: 47,868,667	Y471H	unknown	Het
Zfp407	A	T	18: 84,562,694	V98D	possibly damaging	Het
Zfp598	T	A	17: 24,676,555	V73E	probably damaging	Het
Zscan29	T	A	2: 121,169,886		probably null	Het

Other mutations in Galnt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02187:Galnt2	APN	8	124305506	splice site	probably benign
IGL02638:Galnt2	APN	8	124231579	missense	probably damaging	0.98
chivalry	UTSW	8	124334286	nonsense	probably null
gallantry	UTSW	8	124340822	missense	probably damaging	1.00
valor	UTSW	8	124329788	missense	probably damaging	1.00
P0018:Galnt2	UTSW	8	124336611	missense	probably damaging	1.00
R0133:Galnt2	UTSW	8	124338538	missense	probably benign	0.19
R0453:Galnt2	UTSW	8	124338584	splice site	probably benign
R0709:Galnt2	UTSW	8	124343346	missense	probably benign	0.01
R1015:Galnt2	UTSW	8	124336617	missense	probably benign
R4388:Galnt2	UTSW	8	124295453	critical splice donor site	probably null
R4400:Galnt2	UTSW	8	124324303	missense	probably damaging	1.00
R4448:Galnt2	UTSW	8	124295377	missense	probably benign	0.04
R4449:Galnt2	UTSW	8	124295377	missense	probably benign	0.04
R4450:Galnt2	UTSW	8	124295377	missense	probably benign	0.04
R4927:Galnt2	UTSW	8	124305623	missense	probably damaging	1.00
R5536:Galnt2	UTSW	8	124323673	missense	probably damaging	1.00
R6218:Galnt2	UTSW	8	124343315	missense	probably benign	0.01
R6732:Galnt2	UTSW	8	124340822	missense	probably damaging	1.00
R6795:Galnt2	UTSW	8	124343436	missense	probably damaging	1.00
R6823:Galnt2	UTSW	8	124324011	missense	probably benign
R7173:Galnt2	UTSW	8	124305553	missense	probably benign	0.00
R7479:Galnt2	UTSW	8	124334338	missense	probably damaging	1.00
R7818:Galnt2	UTSW	8	124329788	missense	probably damaging	1.00
R7821:Galnt2	UTSW	8	124343395	missense	possibly damaging	0.51
R7831:Galnt2	UTSW	8	124332078	missense	probably benign	0.04
R8348:Galnt2	UTSW	8	124334286	nonsense	probably null
R8770:Galnt2	UTSW	8	124334286	nonsense	probably null
X0024:Galnt2	UTSW	8	124343345	missense	probably benign	0.28
Z1177:Galnt2	UTSW	8	124343318	missense	probably benign	0.24

Predicted Primers

PCR Primer
(F):5'- GAGCGTAGTCTAGACGTCTCTG -3'
(R):5'- GCAGTGTCCAGAAGCATAAGTC -3'

Sequencing Primer
(F):5'- CTAGACGTCTCTGGGTGATTATGAG -3'
(R):5'- GTGTCCAGAAGCATAAGTCATTCTC -3'

Posted On

2015-07-21