Incidental Mutation 'R4471:Ankrd13b'
ID 329447
Institutional Source Beutler Lab
Gene Symbol Ankrd13b
Ensembl Gene ENSMUSG00000037907
Gene Name ankyrin repeat domain 13b
Synonyms B930093C12Rik
MMRRC Submission 041728-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.557) question?
Stock # R4471 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 77361311-77380504 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 77367040 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Methionine at position 49 (K49M)
Ref Sequence ENSEMBL: ENSMUSP00000119633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037593] [ENSMUST00000092892] [ENSMUST00000145934]
AlphaFold Q5F259
Predicted Effect probably damaging
Transcript: ENSMUST00000037593
AA Change: K264M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073584
Gene: ENSMUSG00000037907
AA Change: K264M

DomainStartEndE-ValueType
ANK 13 43 3.16e2 SMART
ANK 47 76 2.85e-5 SMART
ANK 80 109 1.17e2 SMART
Pfam:GPCR_chapero_1 163 491 5.5e-111 PFAM
UIM 503 522 1.81e-1 SMART
low complexity region 552 580 N/A INTRINSIC
UIM 585 604 3.15e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000092892
AA Change: K264M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090568
Gene: ENSMUSG00000037907
AA Change: K264M

DomainStartEndE-ValueType
ANK 13 43 3.16e2 SMART
ANK 47 76 2.85e-5 SMART
ANK 80 109 1.17e2 SMART
Pfam:GPCR_chapero_1 163 490 3.2e-110 PFAM
UIM 503 522 1.81e-1 SMART
low complexity region 673 686 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000127291
AA Change: K11M
SMART Domains Protein: ENSMUSP00000118247
Gene: ENSMUSG00000037907
AA Change: K11M

DomainStartEndE-ValueType
Pfam:GPCR_chapero_1 1 120 9.7e-31 PFAM
low complexity region 121 133 N/A INTRINSIC
low complexity region 184 200 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143872
Predicted Effect probably damaging
Transcript: ENSMUST00000145934
AA Change: K49M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119633
Gene: ENSMUSG00000037907
AA Change: K49M

DomainStartEndE-ValueType
Pfam:GPCR_chapero_1 2 276 9.7e-90 PFAM
UIM 288 307 1.81e-1 SMART
Meta Mutation Damage Score 0.2601 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk1 A G 3: 127,473,175 (GRCm39) S943P probably damaging Het
Ankdd1a T C 9: 65,410,791 (GRCm39) D398G probably damaging Het
Asah1 A G 8: 41,796,761 (GRCm39) probably null Het
Cdc34b A G 11: 94,633,064 (GRCm39) E88G probably benign Het
Cdh2 T C 18: 16,907,533 (GRCm39) probably null Het
Ceacam1 T A 7: 25,174,025 (GRCm39) N210I possibly damaging Het
Celf3 A G 3: 94,395,585 (GRCm39) probably null Het
Cfap20dc A G 14: 8,536,571 (GRCm38) L212P probably damaging Het
Cmya5 A T 13: 93,228,833 (GRCm39) M2085K probably benign Het
Cpne6 G A 14: 55,754,089 (GRCm39) V469M probably damaging Het
Cyp2j12 A G 4: 96,021,306 (GRCm39) V100A probably benign Het
Dnajb4 A T 3: 151,890,799 (GRCm39) H333Q probably benign Het
Eif3f T C 7: 108,540,153 (GRCm39) V316A possibly damaging Het
Eml1 T C 12: 108,472,894 (GRCm39) probably benign Het
Ern1 C A 11: 106,310,868 (GRCm39) V302L possibly damaging Het
Fam110b A T 4: 5,799,092 (GRCm39) H170L probably benign Het
Fn3krp T G 11: 121,317,499 (GRCm39) D146E probably benign Het
Git1 A G 11: 77,390,650 (GRCm39) T129A probably benign Het
Glrp1 T A 1: 88,431,196 (GRCm39) Q58L unknown Het
Gpatch2 A G 1: 186,965,337 (GRCm39) E281G probably damaging Het
Hipk2 T A 6: 38,713,857 (GRCm39) probably benign Het
Hydin A G 8: 111,313,764 (GRCm39) N4214S probably damaging Het
Icam5 T A 9: 20,946,802 (GRCm39) C443* probably null Het
Impdh1 G A 6: 29,204,631 (GRCm39) Q307* probably null Het
Ivns1abp C T 1: 151,236,990 (GRCm39) T447M probably benign Het
Lman1 A T 18: 66,124,797 (GRCm39) probably benign Het
Mdn1 A G 4: 32,668,860 (GRCm39) E306G probably benign Het
Msc G C 1: 14,825,902 (GRCm39) P24R probably damaging Het
Mtif2 T C 11: 29,490,053 (GRCm39) probably benign Het
Mvp C T 7: 126,601,130 (GRCm39) M1I probably null Het
Myh7 A T 14: 55,229,311 (GRCm39) Y162* probably null Het
Nemf G A 12: 69,361,216 (GRCm39) H956Y probably benign Het
Nktr T C 9: 121,577,962 (GRCm39) probably benign Het
Nrxn3 T C 12: 90,171,515 (GRCm39) S276P probably damaging Het
Or8d1 T C 9: 38,766,927 (GRCm39) S190P probably damaging Het
Patj A G 4: 98,423,816 (GRCm39) K621E probably damaging Het
Prss2 A G 6: 41,499,780 (GRCm39) I24V probably damaging Het
R3hcc1l T C 19: 42,571,259 (GRCm39) probably benign Het
Rest T C 5: 77,429,027 (GRCm39) V482A probably benign Het
Rexo1 A T 10: 80,378,492 (GRCm39) S476T probably damaging Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Slc16a3 T C 11: 120,846,774 (GRCm39) probably benign Het
Slc5a4b G A 10: 75,894,725 (GRCm39) Q594* probably null Het
Slk T G 19: 47,603,862 (GRCm39) V202G probably damaging Het
Smarca2 T A 19: 26,597,277 (GRCm39) V53D possibly damaging Het
Snrnp200 T A 2: 127,080,673 (GRCm39) V2036E probably benign Het
Sox5 A G 6: 143,790,491 (GRCm39) M523T possibly damaging Het
Syt17 A G 7: 118,036,040 (GRCm39) probably null Het
Taf2 T C 15: 54,922,276 (GRCm39) D337G possibly damaging Het
Tcstv2a G T 13: 120,725,579 (GRCm39) R81L probably benign Het
Tecrl A G 5: 83,461,134 (GRCm39) Y108H probably benign Het
Tln1 A T 4: 43,551,018 (GRCm39) F409L probably benign Het
Tmem59l A G 8: 70,939,951 (GRCm39) L6S unknown Het
Ttc23 G A 7: 67,319,904 (GRCm39) R187Q probably benign Het
Ttl T C 2: 128,923,977 (GRCm39) V230A probably benign Het
Ube2u G A 4: 100,338,843 (GRCm39) W36* probably null Het
Ube4a A T 9: 44,857,830 (GRCm39) probably benign Het
Ulk1 C T 5: 110,937,223 (GRCm39) R691Q probably benign Het
Unc45a A G 7: 79,982,728 (GRCm39) I399T possibly damaging Het
Utp25 C T 1: 192,812,445 (GRCm39) R5Q possibly damaging Het
Wdr59 A C 8: 112,193,419 (GRCm39) probably null Het
Zfp24 A G 18: 24,151,172 (GRCm39) probably benign Het
Zfp777 A T 6: 48,019,041 (GRCm39) W342R probably damaging Het
Zfp979 A T 4: 147,697,913 (GRCm39) C265* probably null Het
Zzef1 T A 11: 72,804,157 (GRCm39) L2633Q probably damaging Het
Other mutations in Ankrd13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Ankrd13b APN 11 77,363,578 (GRCm39) missense probably damaging 1.00
IGL01396:Ankrd13b APN 11 77,363,198 (GRCm39) splice site probably null
IGL02731:Ankrd13b APN 11 77,367,045 (GRCm39) missense probably damaging 0.99
R0310:Ankrd13b UTSW 11 77,363,571 (GRCm39) missense possibly damaging 0.71
R0496:Ankrd13b UTSW 11 77,363,867 (GRCm39) missense probably damaging 1.00
R0511:Ankrd13b UTSW 11 77,364,114 (GRCm39) missense possibly damaging 0.89
R0831:Ankrd13b UTSW 11 77,363,585 (GRCm39) missense probably damaging 0.99
R1156:Ankrd13b UTSW 11 77,363,687 (GRCm39) missense probably damaging 1.00
R1237:Ankrd13b UTSW 11 77,365,400 (GRCm39) missense probably damaging 1.00
R2259:Ankrd13b UTSW 11 77,367,168 (GRCm39) missense probably damaging 1.00
R3110:Ankrd13b UTSW 11 77,368,331 (GRCm39) missense possibly damaging 0.67
R3112:Ankrd13b UTSW 11 77,368,331 (GRCm39) missense possibly damaging 0.67
R4190:Ankrd13b UTSW 11 77,367,201 (GRCm39) missense probably damaging 1.00
R4599:Ankrd13b UTSW 11 77,362,494 (GRCm39) missense probably benign
R5253:Ankrd13b UTSW 11 77,364,061 (GRCm39) intron probably benign
R5677:Ankrd13b UTSW 11 77,368,370 (GRCm39) missense probably damaging 0.99
R7073:Ankrd13b UTSW 11 77,363,335 (GRCm39) missense probably benign 0.39
R7388:Ankrd13b UTSW 11 77,363,583 (GRCm39) missense probably benign 0.02
R7417:Ankrd13b UTSW 11 77,367,020 (GRCm39) missense probably damaging 0.97
R7592:Ankrd13b UTSW 11 77,367,327 (GRCm39) missense probably benign 0.45
R7596:Ankrd13b UTSW 11 77,363,140 (GRCm39) missense probably benign 0.18
R7643:Ankrd13b UTSW 11 77,363,911 (GRCm39) missense probably benign 0.01
R8434:Ankrd13b UTSW 11 77,368,552 (GRCm39) missense probably benign 0.01
R8959:Ankrd13b UTSW 11 77,367,452 (GRCm39) missense probably damaging 1.00
R9668:Ankrd13b UTSW 11 77,368,594 (GRCm39) missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- GAGCCTTGGATGTGACTACC -3'
(R):5'- TGGTGTACATGGAGACCCTG -3'

Sequencing Primer
(F):5'- AGCCTTGGATGTGACTACCCTAAG -3'
(R):5'- ACAGGTGCTGAGCAGGCTTAC -3'
Posted On 2015-07-21