Incidental Mutation 'R4471:Ube4a'
ID 329439
Institutional Source Beutler Lab
Gene Symbol Ube4a
Ensembl Gene ENSMUSG00000059890
Gene Name ubiquitination factor E4A
Synonyms 9930123J21Rik, UFD2b, 4732444G18Rik
MMRRC Submission 041728-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4471 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 44923127-44965600 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) A to T at 44946532 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117506] [ENSMUST00000117549] [ENSMUST00000138559] [ENSMUST00000145657] [ENSMUST00000154287] [ENSMUST00000213193] [ENSMUST00000213890]
AlphaFold E9Q735
Predicted Effect probably benign
Transcript: ENSMUST00000117506
SMART Domains Protein: ENSMUSP00000113346
Gene: ENSMUSG00000059890

DomainStartEndE-ValueType
low complexity region 288 299 N/A INTRINSIC
Pfam:Ufd2P_core 330 766 2.6e-101 PFAM
Pfam:Ufd2P_core 762 935 7.4e-61 PFAM
Ubox 953 1016 1.9e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117549
SMART Domains Protein: ENSMUSP00000112632
Gene: ENSMUSG00000059890

DomainStartEndE-ValueType
low complexity region 307 318 N/A INTRINSIC
Pfam:Ufd2P_core 349 991 3.4e-155 PFAM
Ubox 1010 1073 1.9e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138559
Predicted Effect probably benign
Transcript: ENSMUST00000145657
Predicted Effect probably benign
Transcript: ENSMUST00000154287
SMART Domains Protein: ENSMUSP00000123668
Gene: ENSMUSG00000059890

DomainStartEndE-ValueType
low complexity region 307 318 N/A INTRINSIC
Pfam:Ufd2P_core 349 547 4.1e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213193
Predicted Effect probably benign
Transcript: ENSMUST00000213890
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the U-box ubiquitin ligase family. The encoded protein is involved in multiubiquitin chain assembly and plays a critical role in chromosome condensation and separation through the polyubiquitination of securin. Autoantibodies against the encoded protein may be markers for scleroderma and Crohn's disease. A pseudogene of this gene is located on the long arm of chromosome 3. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A G 14: 8,536,571 L212P probably damaging Het
AF067061 G T 13: 120,264,043 R81L probably benign Het
Alpk1 A G 3: 127,679,526 S943P probably damaging Het
Ankdd1a T C 9: 65,503,509 D398G probably damaging Het
Ankrd13b T A 11: 77,476,214 K49M probably damaging Het
Asah1 A G 8: 41,343,724 probably null Het
Cdc34b A G 11: 94,742,238 E88G probably benign Het
Cdh2 T C 18: 16,774,476 probably null Het
Ceacam1 T A 7: 25,474,600 N210I possibly damaging Het
Celf3 A G 3: 94,488,278 probably null Het
Cmya5 A T 13: 93,092,325 M2085K probably benign Het
Cpne6 G A 14: 55,516,632 V469M probably damaging Het
Cyp2j12 A G 4: 96,133,069 V100A probably benign Het
Diexf C T 1: 193,130,137 R5Q possibly damaging Het
Dnajb4 A T 3: 152,185,162 H333Q probably benign Het
Eif3f T C 7: 108,940,946 V316A possibly damaging Het
Eml1 T C 12: 108,506,635 probably benign Het
Ern1 C A 11: 106,420,042 V302L possibly damaging Het
Fam110b A T 4: 5,799,092 H170L probably benign Het
Fn3krp T G 11: 121,426,673 D146E probably benign Het
Git1 A G 11: 77,499,824 T129A probably benign Het
Glrp1 T A 1: 88,503,474 Q58L unknown Het
Gpatch2 A G 1: 187,233,140 E281G probably damaging Het
Hipk2 T A 6: 38,736,922 probably benign Het
Hydin A G 8: 110,587,132 N4214S probably damaging Het
Icam5 T A 9: 21,035,506 C443* probably null Het
Impdh1 G A 6: 29,204,632 Q307* probably null Het
Ivns1abp C T 1: 151,361,239 T447M probably benign Het
Lman1 A T 18: 65,991,726 probably benign Het
Mdn1 A G 4: 32,668,860 E306G probably benign Het
Msc G C 1: 14,755,678 P24R probably damaging Het
Mtif2 T C 11: 29,540,053 probably benign Het
Mvp C T 7: 127,001,958 M1I probably null Het
Myh7 A T 14: 54,991,854 Y162* probably null Het
Nemf G A 12: 69,314,442 H956Y probably benign Het
Nktr T C 9: 121,748,896 probably benign Het
Nrxn3 T C 12: 90,204,741 S276P probably damaging Het
Olfr26 T C 9: 38,855,631 S190P probably damaging Het
Patj A G 4: 98,535,579 K621E probably damaging Het
Prss2 A G 6: 41,522,846 I24V probably damaging Het
R3hcc1l T C 19: 42,582,820 probably benign Het
Rest T C 5: 77,281,180 V482A probably benign Het
Rexo1 A T 10: 80,542,658 S476T probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Slc16a3 T C 11: 120,955,948 probably benign Het
Slc5a4b G A 10: 76,058,891 Q594* probably null Het
Slk T G 19: 47,615,423 V202G probably damaging Het
Smarca2 T A 19: 26,619,877 V53D possibly damaging Het
Snrnp200 T A 2: 127,238,753 V2036E probably benign Het
Sox5 A G 6: 143,844,765 M523T possibly damaging Het
Syt17 A G 7: 118,436,817 probably null Het
Taf2 T C 15: 55,058,880 D337G possibly damaging Het
Tecrl A G 5: 83,313,287 Y108H probably benign Het
Tln1 A T 4: 43,551,018 F409L probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Ttc23 G A 7: 67,670,156 R187Q probably benign Het
Ttl T C 2: 129,082,057 V230A probably benign Het
Ube2u G A 4: 100,481,646 W36* probably null Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Unc45a A G 7: 80,332,980 I399T possibly damaging Het
Wdr59 A C 8: 111,466,787 probably null Het
Zfp24 A G 18: 24,018,115 probably benign Het
Zfp777 A T 6: 48,042,107 W342R probably damaging Het
Zfp979 A T 4: 147,613,456 C265* probably null Het
Zzef1 T A 11: 72,913,331 L2633Q probably damaging Het
Other mutations in Ube4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Ube4a APN 9 44948141 missense probably damaging 1.00
IGL00857:Ube4a APN 9 44932386 missense probably damaging 1.00
IGL01067:Ube4a APN 9 44944865 missense probably damaging 0.96
White_way UTSW 9 44949753 nonsense probably null
R0243:Ube4a UTSW 9 44946178 unclassified probably benign
R0355:Ube4a UTSW 9 44944801 splice site probably benign
R0680:Ube4a UTSW 9 44948060 missense probably damaging 1.00
R0863:Ube4a UTSW 9 44949816 missense possibly damaging 0.55
R0909:Ube4a UTSW 9 44939973 missense probably damaging 0.97
R1597:Ube4a UTSW 9 44929766 missense possibly damaging 0.93
R1611:Ube4a UTSW 9 44956737 intron probably benign
R1871:Ube4a UTSW 9 44944937 splice site probably null
R2069:Ube4a UTSW 9 44948099 missense probably damaging 0.96
R2518:Ube4a UTSW 9 44948137 missense probably benign 0.29
R3079:Ube4a UTSW 9 44960073 missense probably damaging 1.00
R3404:Ube4a UTSW 9 44929687 missense probably damaging 1.00
R3726:Ube4a UTSW 9 44933323 missense probably damaging 0.97
R3758:Ube4a UTSW 9 44949900 unclassified probably benign
R4027:Ube4a UTSW 9 44949900 unclassified probably benign
R4029:Ube4a UTSW 9 44949900 unclassified probably benign
R4111:Ube4a UTSW 9 44948949 missense probably damaging 0.97
R4113:Ube4a UTSW 9 44948949 missense probably damaging 0.97
R4238:Ube4a UTSW 9 44939999 missense probably damaging 1.00
R4365:Ube4a UTSW 9 44960081 missense probably damaging 1.00
R4793:Ube4a UTSW 9 44948822 missense probably damaging 1.00
R5069:Ube4a UTSW 9 44940089 missense probably damaging 1.00
R5214:Ube4a UTSW 9 44948868 missense probably benign 0.22
R5225:Ube4a UTSW 9 44939960 critical splice donor site probably null
R5416:Ube4a UTSW 9 44941178 missense probably damaging 0.99
R5641:Ube4a UTSW 9 44950881 missense probably damaging 0.99
R5729:Ube4a UTSW 9 44933329 missense probably damaging 1.00
R5774:Ube4a UTSW 9 44953097 missense probably damaging 0.99
R5908:Ube4a UTSW 9 44948024 critical splice donor site probably null
R6191:Ube4a UTSW 9 44949753 nonsense probably null
R6752:Ube4a UTSW 9 44925948 missense probably damaging 1.00
R6886:Ube4a UTSW 9 44948843 missense probably damaging 0.96
R6911:Ube4a UTSW 9 44942758 missense probably damaging 1.00
R7417:Ube4a UTSW 9 44956713 missense probably benign 0.08
R7650:Ube4a UTSW 9 44933436 missense probably damaging 0.99
R7747:Ube4a UTSW 9 44925973 missense probably damaging 1.00
R7798:Ube4a UTSW 9 44933331 missense probably damaging 1.00
R7842:Ube4a UTSW 9 44949727 splice site probably null
R7853:Ube4a UTSW 9 44953010 missense probably benign 0.43
R8109:Ube4a UTSW 9 44935483 missense probably benign 0.00
R8223:Ube4a UTSW 9 44960035 missense possibly damaging 0.94
R8401:Ube4a UTSW 9 44941229 missense possibly damaging 0.84
R8523:Ube4a UTSW 9 44949832 missense probably damaging 1.00
R8838:Ube4a UTSW 9 44925963 missense probably damaging 1.00
R9093:Ube4a UTSW 9 44953164 missense possibly damaging 0.66
R9314:Ube4a UTSW 9 44942725 missense probably benign 0.00
R9365:Ube4a UTSW 9 44950893 missense probably benign 0.09
R9545:Ube4a UTSW 9 44932340 critical splice donor site probably null
X0025:Ube4a UTSW 9 44942818 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- ATTTCGGGCATCTGATTGGC -3'
(R):5'- TAAATCTGTGCAATATGGCAGCTG -3'

Sequencing Primer
(F):5'- GCATCTGATTGGCCCAGATC -3'
(R):5'- TGCAATATGGCAGCTGACCAG -3'
Posted On 2015-07-21