Incidental Mutation 'R4471:Tmem59l'
ID 329434
Institutional Source Beutler Lab
Gene Symbol Tmem59l
Ensembl Gene ENSMUSG00000035964
Gene Name transmembrane protein 59-like
Synonyms 5330410G16Rik
MMRRC Submission 041728-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.055) question?
Stock # R4471 (G1)
Quality Score 109
Status Validated
Chromosome 8
Chromosomal Location 70936517-70940008 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 70939951 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 6 (L6S)
Ref Sequence ENSEMBL: ENSMUSP00000043659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045286]
AlphaFold Q7TNI2
Predicted Effect unknown
Transcript: ENSMUST00000045286
AA Change: L6S
SMART Domains Protein: ENSMUSP00000043659
Gene: ENSMUSG00000035964
AA Change: L6S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 33 41 N/A INTRINSIC
low complexity region 44 60 N/A INTRINSIC
Pfam:BSMAP 72 278 1e-67 PFAM
low complexity region 311 319 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211264
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a predicted type-I membrane glycoprotein. The encoded protein may play a role in functioning of the central nervous system. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk1 A G 3: 127,473,175 (GRCm39) S943P probably damaging Het
Ankdd1a T C 9: 65,410,791 (GRCm39) D398G probably damaging Het
Ankrd13b T A 11: 77,367,040 (GRCm39) K49M probably damaging Het
Asah1 A G 8: 41,796,761 (GRCm39) probably null Het
Cdc34b A G 11: 94,633,064 (GRCm39) E88G probably benign Het
Cdh2 T C 18: 16,907,533 (GRCm39) probably null Het
Ceacam1 T A 7: 25,174,025 (GRCm39) N210I possibly damaging Het
Celf3 A G 3: 94,395,585 (GRCm39) probably null Het
Cfap20dc A G 14: 8,536,571 (GRCm38) L212P probably damaging Het
Cmya5 A T 13: 93,228,833 (GRCm39) M2085K probably benign Het
Cpne6 G A 14: 55,754,089 (GRCm39) V469M probably damaging Het
Cyp2j12 A G 4: 96,021,306 (GRCm39) V100A probably benign Het
Dnajb4 A T 3: 151,890,799 (GRCm39) H333Q probably benign Het
Eif3f T C 7: 108,540,153 (GRCm39) V316A possibly damaging Het
Eml1 T C 12: 108,472,894 (GRCm39) probably benign Het
Ern1 C A 11: 106,310,868 (GRCm39) V302L possibly damaging Het
Fam110b A T 4: 5,799,092 (GRCm39) H170L probably benign Het
Fn3krp T G 11: 121,317,499 (GRCm39) D146E probably benign Het
Git1 A G 11: 77,390,650 (GRCm39) T129A probably benign Het
Glrp1 T A 1: 88,431,196 (GRCm39) Q58L unknown Het
Gpatch2 A G 1: 186,965,337 (GRCm39) E281G probably damaging Het
Hipk2 T A 6: 38,713,857 (GRCm39) probably benign Het
Hydin A G 8: 111,313,764 (GRCm39) N4214S probably damaging Het
Icam5 T A 9: 20,946,802 (GRCm39) C443* probably null Het
Impdh1 G A 6: 29,204,631 (GRCm39) Q307* probably null Het
Ivns1abp C T 1: 151,236,990 (GRCm39) T447M probably benign Het
Lman1 A T 18: 66,124,797 (GRCm39) probably benign Het
Mdn1 A G 4: 32,668,860 (GRCm39) E306G probably benign Het
Msc G C 1: 14,825,902 (GRCm39) P24R probably damaging Het
Mtif2 T C 11: 29,490,053 (GRCm39) probably benign Het
Mvp C T 7: 126,601,130 (GRCm39) M1I probably null Het
Myh7 A T 14: 55,229,311 (GRCm39) Y162* probably null Het
Nemf G A 12: 69,361,216 (GRCm39) H956Y probably benign Het
Nktr T C 9: 121,577,962 (GRCm39) probably benign Het
Nrxn3 T C 12: 90,171,515 (GRCm39) S276P probably damaging Het
Or8d1 T C 9: 38,766,927 (GRCm39) S190P probably damaging Het
Patj A G 4: 98,423,816 (GRCm39) K621E probably damaging Het
Prss2 A G 6: 41,499,780 (GRCm39) I24V probably damaging Het
R3hcc1l T C 19: 42,571,259 (GRCm39) probably benign Het
Rest T C 5: 77,429,027 (GRCm39) V482A probably benign Het
Rexo1 A T 10: 80,378,492 (GRCm39) S476T probably damaging Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Slc16a3 T C 11: 120,846,774 (GRCm39) probably benign Het
Slc5a4b G A 10: 75,894,725 (GRCm39) Q594* probably null Het
Slk T G 19: 47,603,862 (GRCm39) V202G probably damaging Het
Smarca2 T A 19: 26,597,277 (GRCm39) V53D possibly damaging Het
Snrnp200 T A 2: 127,080,673 (GRCm39) V2036E probably benign Het
Sox5 A G 6: 143,790,491 (GRCm39) M523T possibly damaging Het
Syt17 A G 7: 118,036,040 (GRCm39) probably null Het
Taf2 T C 15: 54,922,276 (GRCm39) D337G possibly damaging Het
Tcstv2a G T 13: 120,725,579 (GRCm39) R81L probably benign Het
Tecrl A G 5: 83,461,134 (GRCm39) Y108H probably benign Het
Tln1 A T 4: 43,551,018 (GRCm39) F409L probably benign Het
Ttc23 G A 7: 67,319,904 (GRCm39) R187Q probably benign Het
Ttl T C 2: 128,923,977 (GRCm39) V230A probably benign Het
Ube2u G A 4: 100,338,843 (GRCm39) W36* probably null Het
Ube4a A T 9: 44,857,830 (GRCm39) probably benign Het
Ulk1 C T 5: 110,937,223 (GRCm39) R691Q probably benign Het
Unc45a A G 7: 79,982,728 (GRCm39) I399T possibly damaging Het
Utp25 C T 1: 192,812,445 (GRCm39) R5Q possibly damaging Het
Wdr59 A C 8: 112,193,419 (GRCm39) probably null Het
Zfp24 A G 18: 24,151,172 (GRCm39) probably benign Het
Zfp777 A T 6: 48,019,041 (GRCm39) W342R probably damaging Het
Zfp979 A T 4: 147,697,913 (GRCm39) C265* probably null Het
Zzef1 T A 11: 72,804,157 (GRCm39) L2633Q probably damaging Het
Other mutations in Tmem59l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Tmem59l APN 8 70,938,315 (GRCm39) splice site probably benign
IGL01479:Tmem59l APN 8 70,938,748 (GRCm39) missense probably benign 0.00
IGL01783:Tmem59l APN 8 70,939,874 (GRCm39) missense probably damaging 1.00
IGL01998:Tmem59l APN 8 70,937,431 (GRCm39) missense probably benign 0.16
R0973:Tmem59l UTSW 8 70,938,710 (GRCm39) missense possibly damaging 0.93
R0973:Tmem59l UTSW 8 70,938,710 (GRCm39) missense possibly damaging 0.93
R0974:Tmem59l UTSW 8 70,938,710 (GRCm39) missense possibly damaging 0.93
R1201:Tmem59l UTSW 8 70,937,037 (GRCm39) nonsense probably null
R1540:Tmem59l UTSW 8 70,937,804 (GRCm39) missense probably benign 0.05
R1775:Tmem59l UTSW 8 70,938,903 (GRCm39) missense probably damaging 1.00
R2217:Tmem59l UTSW 8 70,939,951 (GRCm39) missense unknown
R2238:Tmem59l UTSW 8 70,937,772 (GRCm39) missense probably damaging 0.99
R2313:Tmem59l UTSW 8 70,939,951 (GRCm39) missense unknown
R2315:Tmem59l UTSW 8 70,939,951 (GRCm39) missense unknown
R2969:Tmem59l UTSW 8 70,939,951 (GRCm39) missense unknown
R2970:Tmem59l UTSW 8 70,939,951 (GRCm39) missense unknown
R3011:Tmem59l UTSW 8 70,938,887 (GRCm39) missense probably damaging 1.00
R3725:Tmem59l UTSW 8 70,939,951 (GRCm39) missense unknown
R3726:Tmem59l UTSW 8 70,939,951 (GRCm39) missense unknown
R3774:Tmem59l UTSW 8 70,939,951 (GRCm39) missense unknown
R3775:Tmem59l UTSW 8 70,939,951 (GRCm39) missense unknown
R3826:Tmem59l UTSW 8 70,939,951 (GRCm39) missense unknown
R3827:Tmem59l UTSW 8 70,939,951 (GRCm39) missense unknown
R3828:Tmem59l UTSW 8 70,939,951 (GRCm39) missense unknown
R3829:Tmem59l UTSW 8 70,939,951 (GRCm39) missense unknown
R3851:Tmem59l UTSW 8 70,939,951 (GRCm39) missense unknown
R3943:Tmem59l UTSW 8 70,939,951 (GRCm39) missense unknown
R3944:Tmem59l UTSW 8 70,939,951 (GRCm39) missense unknown
R4064:Tmem59l UTSW 8 70,938,369 (GRCm39) missense probably damaging 1.00
R4409:Tmem59l UTSW 8 70,939,951 (GRCm39) missense unknown
R4410:Tmem59l UTSW 8 70,939,951 (GRCm39) missense unknown
R4422:Tmem59l UTSW 8 70,938,749 (GRCm39) missense probably damaging 0.98
R4470:Tmem59l UTSW 8 70,939,951 (GRCm39) missense unknown
R4767:Tmem59l UTSW 8 70,938,748 (GRCm39) missense probably benign 0.00
R5321:Tmem59l UTSW 8 70,939,865 (GRCm39) missense probably damaging 1.00
R6130:Tmem59l UTSW 8 70,937,255 (GRCm39) missense probably damaging 1.00
R6527:Tmem59l UTSW 8 70,938,775 (GRCm39) missense probably damaging 1.00
R6603:Tmem59l UTSW 8 70,939,006 (GRCm39) missense probably benign 0.31
R6750:Tmem59l UTSW 8 70,939,022 (GRCm39) missense probably benign 0.34
R7542:Tmem59l UTSW 8 70,937,814 (GRCm39) missense possibly damaging 0.56
R8265:Tmem59l UTSW 8 70,938,426 (GRCm39) missense probably damaging 0.99
R9320:Tmem59l UTSW 8 70,937,822 (GRCm39) missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- TTCCATCTGAGGGTCCTACAC -3'
(R):5'- ATCCAAGTCCGGTCAAAGAGC -3'

Sequencing Primer
(F):5'- AGGGTCCTACACTCAGGTC -3'
(R):5'- TCAGTGACGTCAACACC -3'
Posted On 2015-07-21