Incidental Mutation 'R4950:Ptprd'
List |< first << previous [record 35 of 53] next >> last >|
ID381907
Institutional Source Beutler Lab
Gene Symbol Ptprd
Ensembl Gene ENSMUSG00000028399
Gene Nameprotein tyrosine phosphatase, receptor type, D
Synonyms1110002J03Rik, 3000002J10Rik, B230219D21Rik
MMRRC Submission 042547-MU
Accession Numbers

Ncbi RefSeq: NM_001014288.2, NM_011211.2; MGI:97812

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4950 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location75941238-78211961 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 76140515 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050757] [ENSMUST00000050757] [ENSMUST00000098005] [ENSMUST00000098005] [ENSMUST00000107289] [ENSMUST00000107289] [ENSMUST00000173376] [ENSMUST00000174023] [ENSMUST00000174023] [ENSMUST00000174180] [ENSMUST00000174180] [ENSMUST00000174531] [ENSMUST00000174531] [ENSMUST00000174831] [ENSMUST00000174831]
Predicted Effect probably null
Transcript: ENSMUST00000050757
SMART Domains Protein: ENSMUSP00000058466
Gene: ENSMUSG00000028399

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 208 1.38e-15 SMART
IGc2 238 299 8.13e-4 SMART
FN3 313 392 7.92e-14 SMART
FN3 408 491 5.73e-11 SMART
IG_like 499 593 8.34e1 SMART
FN3 506 584 9.1e-14 SMART
FN3 597 674 1.21e0 SMART
transmembrane domain 847 869 N/A INTRINSIC
low complexity region 870 882 N/A INTRINSIC
PTPc 949 1207 6.38e-134 SMART
PTPc 1236 1498 9.17e-135 SMART
Predicted Effect probably null
Transcript: ENSMUST00000050757
SMART Domains Protein: ENSMUSP00000058466
Gene: ENSMUSG00000028399

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 208 1.38e-15 SMART
IGc2 238 299 8.13e-4 SMART
FN3 313 392 7.92e-14 SMART
FN3 408 491 5.73e-11 SMART
IG_like 499 593 8.34e1 SMART
FN3 506 584 9.1e-14 SMART
FN3 597 674 1.21e0 SMART
transmembrane domain 847 869 N/A INTRINSIC
low complexity region 870 882 N/A INTRINSIC
PTPc 949 1207 6.38e-134 SMART
PTPc 1236 1498 9.17e-135 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000084467
Predicted Effect probably null
Transcript: ENSMUST00000098005
SMART Domains Protein: ENSMUSP00000095614
Gene: ENSMUSG00000028399

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 214 8.5e-16 SMART
low complexity region 225 237 N/A INTRINSIC
IGc2 248 309 8.13e-4 SMART
FN3 323 402 7.92e-14 SMART
FN3 418 501 5.73e-11 SMART
IG_like 509 603 8.34e1 SMART
FN3 516 594 9.1e-14 SMART
FN3 607 684 1.21e0 SMART
transmembrane domain 857 879 N/A INTRINSIC
low complexity region 886 897 N/A INTRINSIC
PTPc 950 1208 6.38e-134 SMART
PTPc 1237 1499 9.17e-135 SMART
Predicted Effect probably null
Transcript: ENSMUST00000098005
SMART Domains Protein: ENSMUSP00000095614
Gene: ENSMUSG00000028399

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 214 8.5e-16 SMART
low complexity region 225 237 N/A INTRINSIC
IGc2 248 309 8.13e-4 SMART
FN3 323 402 7.92e-14 SMART
FN3 418 501 5.73e-11 SMART
IG_like 509 603 8.34e1 SMART
FN3 516 594 9.1e-14 SMART
FN3 607 684 1.21e0 SMART
transmembrane domain 857 879 N/A INTRINSIC
low complexity region 886 897 N/A INTRINSIC
PTPc 950 1208 6.38e-134 SMART
PTPc 1237 1499 9.17e-135 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107287
Predicted Effect probably null
Transcript: ENSMUST00000107289
SMART Domains Protein: ENSMUSP00000102910
Gene: ENSMUSG00000028399

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 214 8.5e-16 SMART
low complexity region 225 237 N/A INTRINSIC
IGc2 248 309 8.13e-4 SMART
FN3 323 402 7.92e-14 SMART
FN3 418 501 5.73e-11 SMART
IG_like 509 603 8.34e1 SMART
FN3 516 594 9.1e-14 SMART
FN3 609 696 2.72e-12 SMART
FN3 712 809 2.87e-11 SMART
FN3 824 904 4.96e-6 SMART
FN3 919 1003 4.12e-12 SMART
FN3 1018 1095 1.95e0 SMART
transmembrane domain 1268 1290 N/A INTRINSIC
low complexity region 1291 1303 N/A INTRINSIC
PTPc 1356 1614 6.38e-134 SMART
PTPc 1643 1905 9.17e-135 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107289
SMART Domains Protein: ENSMUSP00000102910
Gene: ENSMUSG00000028399

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 214 8.5e-16 SMART
low complexity region 225 237 N/A INTRINSIC
IGc2 248 309 8.13e-4 SMART
FN3 323 402 7.92e-14 SMART
FN3 418 501 5.73e-11 SMART
IG_like 509 603 8.34e1 SMART
FN3 516 594 9.1e-14 SMART
FN3 609 696 2.72e-12 SMART
FN3 712 809 2.87e-11 SMART
FN3 824 904 4.96e-6 SMART
FN3 919 1003 4.12e-12 SMART
FN3 1018 1095 1.95e0 SMART
transmembrane domain 1268 1290 N/A INTRINSIC
low complexity region 1291 1303 N/A INTRINSIC
PTPc 1356 1614 6.38e-134 SMART
PTPc 1643 1905 9.17e-135 SMART
Predicted Effect probably null
Transcript: ENSMUST00000173376
SMART Domains Protein: ENSMUSP00000133468
Gene: ENSMUSG00000028399

DomainStartEndE-ValueType
IGc2 43 112 8.57e-12 SMART
IGc2 145 221 8.5e-16 SMART
low complexity region 232 244 N/A INTRINSIC
IGc2 255 316 8.13e-4 SMART
FN3 330 409 7.92e-14 SMART
FN3 425 508 5.73e-11 SMART
IG_like 516 610 8.34e1 SMART
FN3 523 601 9.1e-14 SMART
FN3 614 691 1.21e0 SMART
transmembrane domain 864 886 N/A INTRINSIC
low complexity region 887 899 N/A INTRINSIC
PTPc 952 1210 6.38e-134 SMART
PTPc 1239 1501 9.17e-135 SMART
Predicted Effect probably null
Transcript: ENSMUST00000174023
SMART Domains Protein: ENSMUSP00000133562
Gene: ENSMUSG00000028399

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 211 4.88e-16 SMART
low complexity region 222 234 N/A INTRINSIC
IGc2 245 306 8.13e-4 SMART
FN3 320 399 7.92e-14 SMART
FN3 415 498 5.73e-11 SMART
IG_like 506 600 8.34e1 SMART
FN3 513 591 9.1e-14 SMART
FN3 604 681 1.21e0 SMART
transmembrane domain 853 875 N/A INTRINSIC
low complexity region 882 893 N/A INTRINSIC
PTPc 946 1204 6.38e-134 SMART
PTPc 1233 1495 9.17e-135 SMART
Predicted Effect probably null
Transcript: ENSMUST00000174023
SMART Domains Protein: ENSMUSP00000133562
Gene: ENSMUSG00000028399

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 211 4.88e-16 SMART
low complexity region 222 234 N/A INTRINSIC
IGc2 245 306 8.13e-4 SMART
FN3 320 399 7.92e-14 SMART
FN3 415 498 5.73e-11 SMART
IG_like 506 600 8.34e1 SMART
FN3 513 591 9.1e-14 SMART
FN3 604 681 1.21e0 SMART
transmembrane domain 853 875 N/A INTRINSIC
low complexity region 882 893 N/A INTRINSIC
PTPc 946 1204 6.38e-134 SMART
PTPc 1233 1495 9.17e-135 SMART
Predicted Effect probably null
Transcript: ENSMUST00000174180
SMART Domains Protein: ENSMUSP00000133973
Gene: ENSMUSG00000028399

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 205 2.09e-15 SMART
IGc2 235 296 8.13e-4 SMART
FN3 310 389 7.92e-14 SMART
FN3 405 488 5.73e-11 SMART
IG_like 496 590 8.34e1 SMART
FN3 503 581 9.1e-14 SMART
FN3 596 683 2.72e-12 SMART
FN3 699 787 6.15e-11 SMART
FN3 802 882 4.96e-6 SMART
FN3 897 981 4.12e-12 SMART
FN3 996 1073 1.95e0 SMART
transmembrane domain 1246 1268 N/A INTRINSIC
low complexity region 1269 1281 N/A INTRINSIC
PTPc 1334 1592 6.38e-134 SMART
PTPc 1621 1883 9.17e-135 SMART
Predicted Effect probably null
Transcript: ENSMUST00000174180
SMART Domains Protein: ENSMUSP00000133973
Gene: ENSMUSG00000028399

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 205 2.09e-15 SMART
IGc2 235 296 8.13e-4 SMART
FN3 310 389 7.92e-14 SMART
FN3 405 488 5.73e-11 SMART
IG_like 496 590 8.34e1 SMART
FN3 503 581 9.1e-14 SMART
FN3 596 683 2.72e-12 SMART
FN3 699 787 6.15e-11 SMART
FN3 802 882 4.96e-6 SMART
FN3 897 981 4.12e-12 SMART
FN3 996 1073 1.95e0 SMART
transmembrane domain 1246 1268 N/A INTRINSIC
low complexity region 1269 1281 N/A INTRINSIC
PTPc 1334 1592 6.38e-134 SMART
PTPc 1621 1883 9.17e-135 SMART
Predicted Effect probably null
Transcript: ENSMUST00000174531
SMART Domains Protein: ENSMUSP00000134229
Gene: ENSMUSG00000028399

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 208 1.38e-15 SMART
low complexity region 219 231 N/A INTRINSIC
IGc2 242 303 8.13e-4 SMART
FN3 317 396 7.92e-14 SMART
FN3 412 495 5.73e-11 SMART
IG_like 503 597 8.34e1 SMART
FN3 510 588 9.1e-14 SMART
FN3 601 678 1.21e0 SMART
transmembrane domain 851 873 N/A INTRINSIC
low complexity region 874 886 N/A INTRINSIC
PTPc 939 1197 6.38e-134 SMART
PTPc 1226 1488 9.17e-135 SMART
Predicted Effect probably null
Transcript: ENSMUST00000174531
SMART Domains Protein: ENSMUSP00000134229
Gene: ENSMUSG00000028399

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 208 1.38e-15 SMART
low complexity region 219 231 N/A INTRINSIC
IGc2 242 303 8.13e-4 SMART
FN3 317 396 7.92e-14 SMART
FN3 412 495 5.73e-11 SMART
IG_like 503 597 8.34e1 SMART
FN3 510 588 9.1e-14 SMART
FN3 601 678 1.21e0 SMART
transmembrane domain 851 873 N/A INTRINSIC
low complexity region 874 886 N/A INTRINSIC
PTPc 939 1197 6.38e-134 SMART
PTPc 1226 1488 9.17e-135 SMART
Predicted Effect probably null
Transcript: ENSMUST00000174831
SMART Domains Protein: ENSMUSP00000133328
Gene: ENSMUSG00000028399

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 214 8.5e-16 SMART
low complexity region 225 237 N/A INTRINSIC
IGc2 248 309 8.13e-4 SMART
FN3 323 402 7.92e-14 SMART
FN3 418 501 5.73e-11 SMART
IG_like 509 603 8.34e1 SMART
FN3 516 594 9.1e-14 SMART
FN3 607 684 1.21e0 SMART
transmembrane domain 856 878 N/A INTRINSIC
low complexity region 885 896 N/A INTRINSIC
PTPc 949 1207 6.38e-134 SMART
PTPc 1236 1498 9.17e-135 SMART
Predicted Effect probably null
Transcript: ENSMUST00000174831
SMART Domains Protein: ENSMUSP00000133328
Gene: ENSMUSG00000028399

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 214 8.5e-16 SMART
low complexity region 225 237 N/A INTRINSIC
IGc2 248 309 8.13e-4 SMART
FN3 323 402 7.92e-14 SMART
FN3 418 501 5.73e-11 SMART
IG_like 509 603 8.34e1 SMART
FN3 516 594 9.1e-14 SMART
FN3 607 684 1.21e0 SMART
transmembrane domain 856 878 N/A INTRINSIC
low complexity region 885 896 N/A INTRINSIC
PTPc 949 1207 6.38e-134 SMART
PTPc 1236 1498 9.17e-135 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 100% (58/58)
MGI Phenotype Strain: 2158795
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired learning of spatial tasks, enhanced long-term potentiation at hippocampal synapses, and high mortality associated with reduced food intake. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted(4) Gene trapped(5)
 

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bpifb9b A T 2: 154,311,659 D215V probably damaging Het
Cacna1i A G 15: 80,368,671 E625G probably damaging Het
Cage1 C T 13: 38,023,326 S181N possibly damaging Het
Ccdc36 A C 9: 108,421,510 S36R probably damaging Het
Ccdc73 A C 2: 104,992,366 I887L probably benign Het
Cfap65 T A 1: 74,906,336 K1408* probably null Het
Cngb1 C A 8: 95,248,507 G654W probably damaging Het
Cxcl15 A T 5: 90,795,245 E35D possibly damaging Het
Ddi1 A G 9: 6,266,073 S99P probably benign Het
Disp3 A T 4: 148,258,126 D622E possibly damaging Het
Dnajc22 G A 15: 99,101,734 V267I probably benign Het
Dph5 G A 3: 115,928,643 G257S probably benign Het
Elmo2 A T 2: 165,314,813 probably null Het
Fam186a T C 15: 99,941,653 R2237G unknown Het
Fez1 G A 9: 36,867,882 R285Q probably damaging Het
Fsip2 A T 2: 82,946,932 H101L probably damaging Het
Fsip2 G A 2: 82,977,414 C1359Y probably benign Het
Fxyd7 G A 7: 31,047,390 T15I probably benign Het
Gpr155 A T 2: 73,382,185 D31E probably benign Het
Irx6 A T 8: 92,678,800 Y432F probably damaging Het
Itih5 A C 2: 10,235,081 I340L probably damaging Het
Lao1 T C 4: 118,965,375 L164S probably damaging Het
Mcoln3 T C 3: 146,139,519 I490T probably damaging Het
Mef2b T C 8: 70,167,196 Y311H probably damaging Het
Mras A T 9: 99,394,484 L111Q probably damaging Het
Mrc1 A G 2: 14,271,280 D475G probably damaging Het
Nrcam T C 12: 44,598,490 I1155T probably damaging Het
Ntrk1 A G 3: 87,789,611 probably null Het
Olfr58 G A 9: 19,783,731 M199I probably benign Het
Olfr885 T C 9: 38,062,001 I227T probably damaging Het
Parp9 A T 16: 35,948,007 I186F probably damaging Het
Pcdhac2 T A 18: 37,145,230 V421E probably benign Het
Pck1 T A 2: 173,154,827 I178K probably benign Het
Pde6b A G 5: 108,430,703 K836E probably benign Het
Pwp2 A G 10: 78,183,006 Y56H probably benign Het
Rarb G A 14: 16,432,085 probably benign Het
Rpain C G 11: 70,970,921 H50Q probably benign Het
Rps9 CTGTTTG CTG 7: 3,704,759 probably null Het
Rubcn A T 16: 32,843,193 S358T probably damaging Het
Ryr2 G A 13: 11,742,011 R1586C probably damaging Het
Slfn9 T C 11: 82,981,904 I669V probably benign Het
Slx1b T C 7: 126,691,767 probably benign Het
Spsb3 T A 17: 24,887,511 probably benign Het
Tbx15 A G 3: 99,326,384 I288V possibly damaging Het
Tlr2 C A 3: 83,837,332 E481D probably damaging Het
Trim17 A T 11: 58,970,428 D253V probably damaging Het
Trim69 A G 2: 122,178,746 D429G probably damaging Het
Vstm5 A G 9: 15,257,794 probably null Het
Vwa3b A G 1: 37,085,332 Q337R probably benign Het
Zfp113 T C 5: 138,145,472 N172S probably benign Het
Zfp607a T A 7: 27,878,751 H415Q probably damaging Het
Zfp87 G A 13: 67,517,899 T148I probably benign Het
Other mutations in Ptprd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Ptprd APN 4 75998556 nonsense probably null
IGL01067:Ptprd APN 4 76059685 missense probably damaging 1.00
IGL01121:Ptprd APN 4 75954201 splice site probably benign
IGL01531:Ptprd APN 4 76085520 missense probably damaging 0.98
IGL01661:Ptprd APN 4 75954083 missense probably damaging 1.00
IGL01723:Ptprd APN 4 76243673 missense probably damaging 1.00
IGL01735:Ptprd APN 4 76136820 splice site probably null
IGL01810:Ptprd APN 4 76140507 splice site probably benign
IGL01834:Ptprd APN 4 76128595 missense probably damaging 1.00
IGL01835:Ptprd APN 4 76246821 missense probably benign 0.02
IGL01867:Ptprd APN 4 76243647 missense probably damaging 1.00
IGL02582:Ptprd APN 4 75947124 missense probably damaging 1.00
IGL02591:Ptprd APN 4 75982050 missense probably damaging 1.00
IGL02741:Ptprd APN 4 76133284 missense probably damaging 1.00
IGL02866:Ptprd APN 4 76050437 missense probably damaging 1.00
IGL02960:Ptprd APN 4 76128868 missense probably damaging 1.00
IGL03155:Ptprd APN 4 76066219 missense possibly damaging 0.95
IGL03230:Ptprd APN 4 76050417 nonsense probably null
IGL03343:Ptprd APN 4 76059729 missense probably damaging 1.00
unhurried UTSW 4 76100633 nonsense probably null
ANU22:Ptprd UTSW 4 76100456 missense probably damaging 0.99
F5493:Ptprd UTSW 4 76084408 missense probably damaging 1.00
P0033:Ptprd UTSW 4 76128854 nonsense probably null
R0044:Ptprd UTSW 4 76086329 missense probably benign 0.08
R0044:Ptprd UTSW 4 76086329 missense probably benign 0.08
R0076:Ptprd UTSW 4 75947039 splice site probably benign
R0137:Ptprd UTSW 4 76136903 missense probably benign 0.24
R0358:Ptprd UTSW 4 75944989 missense probably damaging 1.00
R0365:Ptprd UTSW 4 76136846 missense probably damaging 1.00
R0385:Ptprd UTSW 4 76128665 missense probably damaging 1.00
R0601:Ptprd UTSW 4 76100474 missense probably benign
R0646:Ptprd UTSW 4 76084403 missense probably damaging 0.99
R0667:Ptprd UTSW 4 75957346 missense probably damaging 1.00
R0707:Ptprd UTSW 4 75957239 missense probably damaging 1.00
R0734:Ptprd UTSW 4 76140597 missense probably damaging 1.00
R0827:Ptprd UTSW 4 76128915 missense probably damaging 0.98
R0932:Ptprd UTSW 4 76136885 missense probably damaging 1.00
R1069:Ptprd UTSW 4 75998487 splice site probably benign
R1069:Ptprd UTSW 4 76100633 nonsense probably null
R1086:Ptprd UTSW 4 76133258 missense probably damaging 1.00
R1439:Ptprd UTSW 4 76066200 missense probably damaging 1.00
R1440:Ptprd UTSW 4 76084552 missense probably damaging 0.98
R1688:Ptprd UTSW 4 75982684 missense probably damaging 1.00
R1858:Ptprd UTSW 4 75947147 missense probably damaging 1.00
R2001:Ptprd UTSW 4 75954122 missense probably damaging 1.00
R2020:Ptprd UTSW 4 76133161 missense probably damaging 1.00
R2023:Ptprd UTSW 4 75957104 missense probably damaging 1.00
R2413:Ptprd UTSW 4 76133200 missense probably damaging 1.00
R2510:Ptprd UTSW 4 76086011 critical splice donor site probably null
R2914:Ptprd UTSW 4 75947101 missense probably damaging 1.00
R2971:Ptprd UTSW 4 76107324 missense probably benign 0.10
R3051:Ptprd UTSW 4 76100630 missense probably damaging 1.00
R3433:Ptprd UTSW 4 76086011 critical splice donor site probably null
R3964:Ptprd UTSW 4 76059836 splice site probably benign
R4009:Ptprd UTSW 4 75956397 missense possibly damaging 0.94
R4394:Ptprd UTSW 4 76128685 missense probably damaging 1.00
R4420:Ptprd UTSW 4 76039377 missense possibly damaging 0.92
R4424:Ptprd UTSW 4 76102963 missense probably benign 0.22
R4575:Ptprd UTSW 4 76243786 missense possibly damaging 0.55
R4578:Ptprd UTSW 4 76243786 missense possibly damaging 0.55
R4715:Ptprd UTSW 4 76107333 missense probably benign 0.03
R4782:Ptprd UTSW 4 76091532 missense probably benign 0.01
R4785:Ptprd UTSW 4 76140553 missense probably benign 0.05
R4799:Ptprd UTSW 4 76091532 missense probably benign 0.01
R4944:Ptprd UTSW 4 76128899 missense probably damaging 1.00
R4969:Ptprd UTSW 4 76133305 missense probably damaging 1.00
R5153:Ptprd UTSW 4 76012102 missense probably damaging 1.00
R5164:Ptprd UTSW 4 76100758 splice site probably null
R5287:Ptprd UTSW 4 75954168 nonsense probably null
R5305:Ptprd UTSW 4 75982626 missense probably damaging 1.00
R5362:Ptprd UTSW 4 76128813 missense probably damaging 1.00
R5403:Ptprd UTSW 4 75954168 nonsense probably null
R5531:Ptprd UTSW 4 76059667 critical splice donor site probably null
R5543:Ptprd UTSW 4 76059753 missense probably damaging 1.00
R5634:Ptprd UTSW 4 76072018 missense probably benign 0.01
R5719:Ptprd UTSW 4 76054602 critical splice acceptor site probably null
R5884:Ptprd UTSW 4 75982690 missense probably damaging 1.00
R6247:Ptprd UTSW 4 76066291 missense probably benign 0.06
R6250:Ptprd UTSW 4 76128995 missense probably damaging 1.00
R6335:Ptprd UTSW 4 75954183 missense probably damaging 1.00
R6352:Ptprd UTSW 4 76091552 splice site probably null
R6533:Ptprd UTSW 4 76128528 missense probably damaging 1.00
R6756:Ptprd UTSW 4 75955299 missense probably damaging 1.00
R6782:Ptprd UTSW 4 76325140 splice site probably null
R7131:Ptprd UTSW 4 76066340 missense probably damaging 1.00
R7170:Ptprd UTSW 4 76071962 missense probably benign 0.06
R7233:Ptprd UTSW 4 76059783 missense probably benign 0.00
R7246:Ptprd UTSW 4 76128676 missense probably damaging 1.00
R7413:Ptprd UTSW 4 76246839 missense probably benign 0.00
R7428:Ptprd UTSW 4 76086468 missense probably benign 0.03
R7442:Ptprd UTSW 4 76059821 nonsense probably null
R7491:Ptprd UTSW 4 76133155 missense probably benign 0.23
R7526:Ptprd UTSW 4 76066327 missense probably benign 0.00
R7609:Ptprd UTSW 4 76072003 missense probably benign 0.03
R7612:Ptprd UTSW 4 76086459 missense probably benign 0.45
R7659:Ptprd UTSW 4 76128916 missense probably benign 0.03
R7743:Ptprd UTSW 4 76086089 missense probably damaging 1.00
R7748:Ptprd UTSW 4 76099504 missense probably null 0.39
R7788:Ptprd UTSW 4 75998604 missense probably damaging 1.00
R7836:Ptprd UTSW 4 75982644 missense probably damaging 0.99
R7937:Ptprd UTSW 4 76095535 missense probably benign 0.00
R8000:Ptprd UTSW 4 76066242 missense possibly damaging 0.95
R8018:Ptprd UTSW 4 76085520 missense probably damaging 0.98
R8072:Ptprd UTSW 4 76086036 missense probably benign 0.01
R8119:Ptprd UTSW 4 76129026 missense probably benign 0.00
R8387:Ptprd UTSW 4 75955289 missense probably damaging 1.00
R8458:Ptprd UTSW 4 76066259 missense probably benign 0.00
RF016:Ptprd UTSW 4 76128655 missense probably benign 0.01
RF023:Ptprd UTSW 4 76128565 missense probably damaging 0.98
Z1176:Ptprd UTSW 4 76133214 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGGATTAAACAGAAGCCGC -3'
(R):5'- TTCCTAGAGGGTTCCCTACG -3'

Sequencing Primer
(F):5'- ACAGGTTCTGGATGAGGCC -3'
(R):5'- TACGATTGATATGGGCCCGCAG -3'
Posted On2016-04-27