Mutagenetix > Incidental Mutation

Incidental Mutation 'R5365:Rptor'

423093

Institutional Source

Beutler Lab

Gene Symbol

Rptor

Ensembl Gene

ENSMUSG00000025583

Gene Name

regulatory associated protein of MTOR, complex 1

Synonyms

Rap, raptor, 4932417H02Rik

MMRRC Submission

042943-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5365 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

119493731-119790402 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 119734539 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 514 (G514D)

Ref Sequence

ENSEMBL: ENSMUSP00000026671 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026671] [ENSMUST00000124401] [ENSMUST00000139728] [ENSMUST00000147781]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000026671
AA Change: G514D

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000026671
Gene: ENSMUSG00000025583
AA Change: G514D

Domain	Start	End	E-Value	Type
Raptor_N	54	207	2.3e-98	SMART
Pfam:HEAT_2	559	668	7.9e-11	PFAM
Pfam:HEAT	602	630	1.9e-6	PFAM
low complexity region	755	772	N/A	INTRINSIC
low complexity region	877	887	N/A	INTRINSIC
low complexity region	939	945	N/A	INTRINSIC
WD40	1012	1050	2.56e1	SMART
WD40	1052	1097	4.28e0	SMART
WD40	1105	1151	1.83e2	SMART
WD40	1154	1194	1.82e-2	SMART
WD40	1200	1240	5.35e-1	SMART
WD40	1246	1281	7.13e0	SMART
WD40	1283	1329	2.67e-1	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000124401
AA Change: G36D

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000125503
Gene: ENSMUSG00000025583
AA Change: G36D

Domain	Start	End	E-Value	Type
Pfam:HEAT	58	88	1.2e-5	PFAM
Pfam:HEAT_2	101	170	3.9e-8	PFAM
Pfam:HEAT	102	130	1.2e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126802

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127899

Predicted Effect

probably benign
Transcript: ENSMUST00000139728

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147772

Predicted Effect

probably benign
Transcript: ENSMUST00000147781

SMART Domains

Protein: ENSMUSP00000124366
Gene: ENSMUSG00000025583

Domain	Start	End	E-Value	Type
Raptor_N	54	207	2.3e-98	SMART

Meta Mutation Damage Score

0.7267

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a subunit of mammalian target of rapamycin complex 1 (mTORC1), a component of the mTOR signaling pathway, which regulates cell growth in response to nutrient and energy levels. The encoded protein may regulate the assembly, localization, and substrate binding of the mTORC1 complex. Homozygous knockout mice for this gene exhibit embryonic lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous mutation of this gene results in lethality prior to somitogenesis. Mice homozygous for a conditional allele activated in dendritic cells exhibit increased susceptibility to induced colitis and expansion of certain populations of dendritic cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	G	11: 9,578,629 (GRCm39)	E4877G	probably damaging	Het
Acss3	C	T	10: 106,840,589 (GRCm39)	A391T	probably damaging	Het
Bcan	T	C	3: 87,896,542 (GRCm39)	Y718C	probably damaging	Het
Bnc2	T	C	4: 84,329,666 (GRCm39)		probably benign	Het
Bpnt2	G	A	4: 4,776,385 (GRCm39)	T190I	probably damaging	Het
Card6	A	G	15: 5,134,888 (GRCm39)	V105A	possibly damaging	Het
Ceacam5	A	G	7: 17,493,473 (GRCm39)	Y832C	probably damaging	Het
Ces2e	T	C	8: 105,653,846 (GRCm39)		probably null	Het
Cpt1b	A	T	15: 89,304,310 (GRCm39)	I480N	possibly damaging	Het
Csmd3	T	C	15: 47,868,145 (GRCm39)	T792A	possibly damaging	Het
Ctsq	T	A	13: 61,185,632 (GRCm39)	I170F	possibly damaging	Het
Cyfip2	A	G	11: 46,138,457 (GRCm39)	S772P	probably damaging	Het
Cyp3a16	A	C	5: 145,389,597 (GRCm39)	M256R	probably damaging	Het
Dgkd	C	T	1: 87,863,138 (GRCm39)	R62C	probably damaging	Het
Ephx3	A	G	17: 32,408,223 (GRCm39)	L67P	probably damaging	Het
Gpc2	A	G	5: 138,273,885 (GRCm39)	Y438H	probably damaging	Het
Hnrnpul2	T	A	19: 8,798,080 (GRCm39)	H145Q	probably benign	Het
Igkv9-120	T	C	6: 68,027,433 (GRCm39)	S116P	probably benign	Het
Itgal	A	G	7: 126,904,522 (GRCm39)	I332V	probably damaging	Het
Lrit1	A	G	14: 36,784,099 (GRCm39)	T476A	probably benign	Het
Lrp1b	T	C	2: 40,537,137 (GRCm39)	H50R	possibly damaging	Het
Marchf7	T	C	2: 60,064,258 (GRCm39)	V178A	possibly damaging	Het
Mbtps2	G	A	X: 156,351,295 (GRCm39)	T157M	possibly damaging	Het
Mdn1	C	T	4: 32,723,690 (GRCm39)	P2542L	probably damaging	Het
Mill2	T	C	7: 18,592,339 (GRCm39)	V320A	probably benign	Het
Mtor	G	A	4: 148,634,587 (GRCm39)	V2403M	probably damaging	Het
Nectin3	T	A	16: 46,284,469 (GRCm39)	K71*	probably null	Het
Or2g25	T	A	17: 37,970,586 (GRCm39)	I213F	probably damaging	Het
Otof	T	C	5: 30,539,144 (GRCm39)	Y1090C	probably damaging	Het
Pigf	A	T	17: 87,331,136 (GRCm39)	V62E	possibly damaging	Het
Pla1a	A	G	16: 38,237,569 (GRCm39)	L43P	probably benign	Het
Sbno1	TCCC	TCC	5: 124,519,929 (GRCm39)		probably null	Het
Tgm4	A	C	9: 122,895,866 (GRCm39)	K223N	probably damaging	Het
Ttn	G	T	2: 76,744,990 (GRCm39)	A5353E	probably damaging	Het
Ywhaq	T	C	12: 21,446,389 (GRCm39)	E159G	possibly damaging	Het
Zdhhc12	A	G	2: 29,983,521 (GRCm39)	V27A	probably damaging	Het

Other mutations in Rptor

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00537:Rptor	APN	11	119,690,271 (GRCm39)	missense	possibly damaging	0.92
IGL01319:Rptor	APN	11	119,781,996 (GRCm39)	missense	probably benign	0.01
IGL01375:Rptor	APN	11	119,787,262 (GRCm39)	missense	possibly damaging	0.68
IGL01899:Rptor	APN	11	119,748,279 (GRCm39)	missense	probably benign	0.04
IGL01927:Rptor	APN	11	119,548,500 (GRCm39)	missense	probably damaging	1.00
IGL02312:Rptor	APN	11	119,737,741 (GRCm39)	missense	possibly damaging	0.84
IGL02620:Rptor	APN	11	119,671,413 (GRCm39)	missense	probably benign	0.12
IGL02651:Rptor	APN	11	119,783,438 (GRCm39)	missense	possibly damaging	0.69
IGL03182:Rptor	APN	11	119,615,971 (GRCm39)	missense	probably damaging	1.00
Velocipede	UTSW	11	119,786,803 (GRCm39)	missense	possibly damaging	0.92
R0103:Rptor	UTSW	11	119,775,793 (GRCm39)	missense	probably benign	0.01
R0179:Rptor	UTSW	11	119,763,193 (GRCm39)	missense	probably benign	0.14
R0217:Rptor	UTSW	11	119,785,738 (GRCm39)	splice site	probably benign
R0219:Rptor	UTSW	11	119,712,603 (GRCm39)	intron	probably benign
R0324:Rptor	UTSW	11	119,783,467 (GRCm39)	missense	probably damaging	1.00
R0432:Rptor	UTSW	11	119,671,379 (GRCm39)	nonsense	probably null
R0718:Rptor	UTSW	11	119,763,202 (GRCm39)	missense	probably benign	0.15
R0730:Rptor	UTSW	11	119,775,780 (GRCm39)	missense	probably benign	0.06
R1019:Rptor	UTSW	11	119,734,569 (GRCm39)	missense	probably damaging	1.00
R1073:Rptor	UTSW	11	119,634,717 (GRCm39)	missense	possibly damaging	0.93
R1424:Rptor	UTSW	11	119,671,419 (GRCm39)	nonsense	probably null
R1579:Rptor	UTSW	11	119,786,827 (GRCm39)	missense	probably benign	0.00
R1766:Rptor	UTSW	11	119,615,887 (GRCm39)	missense	probably damaging	0.99
R1844:Rptor	UTSW	11	119,647,146 (GRCm39)	missense	probably damaging	1.00
R2180:Rptor	UTSW	11	119,615,970 (GRCm39)	missense	probably damaging	1.00
R2274:Rptor	UTSW	11	119,647,148 (GRCm39)	nonsense	probably null
R2275:Rptor	UTSW	11	119,647,148 (GRCm39)	nonsense	probably null
R2408:Rptor	UTSW	11	119,748,277 (GRCm39)	missense	probably damaging	0.99
R2981:Rptor	UTSW	11	119,756,420 (GRCm39)	missense	probably damaging	1.00
R2996:Rptor	UTSW	11	119,747,124 (GRCm39)	missense	probably damaging	1.00
R3001:Rptor	UTSW	11	119,763,197 (GRCm39)	missense	possibly damaging	0.94
R3002:Rptor	UTSW	11	119,763,197 (GRCm39)	missense	possibly damaging	0.94
R3003:Rptor	UTSW	11	119,763,197 (GRCm39)	missense	possibly damaging	0.94
R4358:Rptor	UTSW	11	119,562,171 (GRCm39)	missense	probably damaging	0.98
R4592:Rptor	UTSW	11	119,689,666 (GRCm39)	missense	probably null	1.00
R4647:Rptor	UTSW	11	119,781,989 (GRCm39)	missense	probably benign	0.33
R4666:Rptor	UTSW	11	119,634,708 (GRCm39)	missense	probably damaging	1.00
R4958:Rptor	UTSW	11	119,748,217 (GRCm39)	missense	probably benign	0.29
R4974:Rptor	UTSW	11	119,712,466 (GRCm39)	intron	probably benign
R5073:Rptor	UTSW	11	119,787,305 (GRCm39)	missense	possibly damaging	0.71
R5199:Rptor	UTSW	11	119,494,642 (GRCm39)	missense	probably benign
R5216:Rptor	UTSW	11	119,734,539 (GRCm39)	missense	probably damaging	0.98
R5219:Rptor	UTSW	11	119,734,539 (GRCm39)	missense	probably damaging	0.98
R5277:Rptor	UTSW	11	119,713,782 (GRCm39)	missense	probably damaging	1.00
R5366:Rptor	UTSW	11	119,734,539 (GRCm39)	missense	probably damaging	0.98
R5447:Rptor	UTSW	11	119,734,539 (GRCm39)	missense	probably damaging	0.98
R5630:Rptor	UTSW	11	119,647,075 (GRCm39)	missense	probably benign	0.01
R6220:Rptor	UTSW	11	119,788,268 (GRCm39)	missense	possibly damaging	0.83
R6567:Rptor	UTSW	11	119,786,838 (GRCm39)	missense	probably benign	0.00
R6741:Rptor	UTSW	11	119,786,803 (GRCm39)	missense	possibly damaging	0.92
R6915:Rptor	UTSW	11	119,647,171 (GRCm39)	missense	probably damaging	0.99
R7032:Rptor	UTSW	11	119,737,762 (GRCm39)	missense	probably benign	0.00
R7051:Rptor	UTSW	11	119,765,012 (GRCm39)	utr 3 prime	probably benign
R7396:Rptor	UTSW	11	119,763,181 (GRCm39)	missense	probably benign	0.10
R7429:Rptor	UTSW	11	119,737,654 (GRCm39)	missense	probably damaging	1.00
R7430:Rptor	UTSW	11	119,737,654 (GRCm39)	missense	probably damaging	1.00
R7447:Rptor	UTSW	11	119,775,805 (GRCm39)	missense	probably benign	0.00
R7595:Rptor	UTSW	11	119,634,779 (GRCm39)	missense	possibly damaging	0.82
R7776:Rptor	UTSW	11	119,783,453 (GRCm39)	missense	probably benign	0.01
R7854:Rptor	UTSW	11	119,748,779 (GRCm39)	missense	probably benign	0.02
R8288:Rptor	UTSW	11	119,748,763 (GRCm39)	missense	probably benign	0.02
R8305:Rptor	UTSW	11	119,702,812 (GRCm39)	missense	probably damaging	1.00
R8328:Rptor	UTSW	11	119,783,473 (GRCm39)	missense	probably benign	0.00
R8351:Rptor	UTSW	11	119,783,465 (GRCm39)	missense	probably benign	0.22
R8772:Rptor	UTSW	11	119,615,858 (GRCm39)	missense	probably damaging	1.00
R8871:Rptor	UTSW	11	119,494,751 (GRCm39)	missense	probably benign	0.01
R8925:Rptor	UTSW	11	119,782,036 (GRCm39)	missense	probably benign	0.11
R8927:Rptor	UTSW	11	119,782,036 (GRCm39)	missense	probably benign	0.11
R8981:Rptor	UTSW	11	119,734,508 (GRCm39)	missense	possibly damaging	0.90
R9149:Rptor	UTSW	11	119,777,896 (GRCm39)	missense	probably benign	0.05
R9213:Rptor	UTSW	11	119,494,765 (GRCm39)	missense	probably benign
R9224:Rptor	UTSW	11	119,785,113 (GRCm39)	missense	probably benign	0.11
R9290:Rptor	UTSW	11	119,702,823 (GRCm39)	missense	probably benign	0.00
R9314:Rptor	UTSW	11	119,786,772 (GRCm39)	missense	probably benign	0.43
R9371:Rptor	UTSW	11	119,562,152 (GRCm39)	missense	possibly damaging	0.66
R9719:Rptor	UTSW	11	119,781,940 (GRCm39)	missense	probably benign	0.13
R9751:Rptor	UTSW	11	119,777,964 (GRCm39)	missense	probably benign	0.02
X0050:Rptor	UTSW	11	119,737,231 (GRCm39)	missense	probably benign	0.14
X0066:Rptor	UTSW	11	119,748,692 (GRCm39)	missense	probably benign	0.31
Z0001:Rptor	UTSW	11	119,762,318 (GRCm39)	critical splice acceptor site	probably benign
Z0001:Rptor	UTSW	11	119,748,279 (GRCm39)	critical splice donor site	probably benign
Z0001:Rptor	UTSW	11	119,742,294 (GRCm39)	critical splice donor site	probably benign
Z0001:Rptor	UTSW	11	119,737,578 (GRCm39)	critical splice acceptor site	probably null
Z0001:Rptor	UTSW	11	119,690,145 (GRCm39)	critical splice acceptor site	probably benign
Z0001:Rptor	UTSW	11	119,647,241 (GRCm39)	critical splice donor site	probably benign
Z0001:Rptor	UTSW	11	119,647,062 (GRCm39)	splice site	probably null
Z0001:Rptor	UTSW	11	119,494,798 (GRCm39)	critical splice donor site	probably null
Z0001:Rptor	UTSW	11	119,787,375 (GRCm39)	critical splice donor site	probably benign
Z0001:Rptor	UTSW	11	119,764,977 (GRCm39)	critical splice acceptor site	probably benign

Predicted Primers

PCR Primer
(F):5'- AGCCTTTTCCCAAGTGAAATCTG -3'
(R):5'- GAAGACCAGATTCTCACCCAGG -3'

Sequencing Primer
(F):5'- CAAGTGAAATCTGGCCTTGC -3'
(R):5'- ATTCTCACCCAGGGCAGGAAG -3'

Posted On

2016-08-04