Mutagenetix > Incidental Mutation

Incidental Mutation 'R5569:Enpp3'

435544

Institutional Source

Beutler Lab

Gene Symbol

Enpp3

Ensembl Gene

ENSMUSG00000019989

Gene Name

ectonucleotide pyrophosphatase/phosphodiesterase 3

Synonyms

CD203c

MMRRC Submission

043126-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.236) question?

Stock #

R5569 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

24772406-24842823 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 24778821 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 230 (D230G)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020169]

AlphaFold

Q6DYE8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000020169
AA Change: D653G

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000020169
Gene: ENSMUSG00000019989
AA Change: D653G

Domain	Start	End	E-Value	Type
transmembrane domain	23	45	N/A	INTRINSIC
SO	50	93	1.99e-13	SMART
SO	94	137	7.66e-15	SMART
Pfam:Phosphodiest	161	485	1.7e-87	PFAM
Blast:Endonuclease_NS	543	599	9e-15	BLAST
Endonuclease_NS	626	847	5.41e-16	SMART
NUC	627	856	1.54e-92	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000218343
AA Change: D230G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219861

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.3%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a series of ectoenzymes that are involved in hydrolysis of extracellular nucleotides. These ectoenzymes possess ATPase and ATP pyrophosphatase activities and are type II transmembrane proteins. Expression of the related rat mRNA has been found in a subset of immature glial cells and in the alimentary tract. The corresponding rat protein has been detected in the pancreas, small intestine, colon, and liver. The human mRNA is expressed in glioma cells, prostate, and uterus. Expression of the human protein has been detected in uterus, basophils, and mast cells. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knockout allele exhibit increased numbers of basophils and mast cells with increased susceptibility to chronic allergic responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad10	A	G	5: 121,626,080	S929P	probably damaging	Het
Ackr3	A	G	1: 90,214,841	T341A	probably benign	Het
Acox3	A	G	5: 35,603,033	Y431C	probably damaging	Het
Adamtsl2	G	A	2: 27,102,833	V653M	probably damaging	Het
Anks6	T	C	4: 47,045,007	K300E	probably damaging	Het
Ap5z1	A	T	5: 142,474,451	D495V	probably damaging	Het
Atm	A	T	9: 53,516,450	Y453*	probably null	Het
Atpaf2	A	T	11: 60,416,880	W11R	probably damaging	Het
Capn1	T	A	19: 6,013,660	T129S	probably benign	Het
Cdh17	A	G	4: 11,816,990	I800M	probably damaging	Het
Cfap206	C	T	4: 34,724,892	R69Q	probably damaging	Het
Cp	T	C	3: 19,978,877	Y623H	probably damaging	Het
Dcaf5	A	T	12: 80,340,201	Y384N	probably damaging	Het
Dhx9	A	T	1: 153,467,092	C555S	possibly damaging	Het
Dlg2	A	G	7: 91,968,180	T317A	probably benign	Het
Dsp	C	T	13: 38,192,652	T1471I	probably benign	Het
Ebf1	A	G	11: 44,992,401	M489V	possibly damaging	Het
Eri3	T	C	4: 117,649,356	M294T	possibly damaging	Het
Fat1	T	A	8: 45,039,836	V3842E	probably damaging	Het
Fermt1	T	A	2: 132,915,203	Y569F	possibly damaging	Het
Fscn1	A	G	5: 142,961,044	D199G	probably benign	Het
Glce	A	G	9: 62,070,203	V133A	probably benign	Het
Gm10020	T	C	15: 52,478,228		noncoding transcript	Het
Gm16432	A	T	1: 178,111,596	K678N	possibly damaging	Het
Gm5096	A	C	18: 87,757,268	Y305S	probably damaging	Het
Gtf2h3	C	T	5: 124,584,297	T121I	probably benign	Het
Hk1	A	G	10: 62,286,441	S520P	probably benign	Het
Ighv12-3	A	G	12: 114,366,935	V7A	probably benign	Het
Ighv6-7	C	A	12: 114,455,856	A43S	probably damaging	Het
Inf2	A	G	12: 112,601,679	I222V	possibly damaging	Het
Kmo	T	A	1: 175,655,122	N337K	probably benign	Het
Mcf2l	C	T	8: 13,005,481	R611W	probably damaging	Het
Mipep	A	T	14: 60,802,934	H301L	probably damaging	Het
Mprip	A	T	11: 59,760,963	E1831V	probably damaging	Het
Mrgpra3	T	C	7: 47,590,011	T56A	probably benign	Het
Mtmr14	G	A	6: 113,240,285	V53I	probably damaging	Het
Mycbp2	A	T	14: 103,135,243	W4056R	probably damaging	Het
Myl2	A	T	5: 122,106,720	D151V	possibly damaging	Het
Myo5c	A	T	9: 75,273,510	D727V	probably damaging	Het
Olfr381	A	T	11: 73,486,692	I44N	probably damaging	Het
Olfr466	A	G	13: 65,152,979	T252A	possibly damaging	Het
Olfr504	T	A	7: 108,565,565	M77L	probably benign	Het
Olfr693	A	T	7: 106,678,483	M1K	probably null	Het
Olfr982	A	G	9: 40,074,297	M1V	probably null	Het
Pabpc1l	C	T	2: 164,043,554	T409I	probably benign	Het
Pcgf1	C	T	6: 83,079,705	R81*	probably null	Het
Pcgf2	A	G	11: 97,692,367		probably null	Het
Phf14	T	A	6: 11,934,016	N292K	probably damaging	Het
Plin4	T	C	17: 56,102,147	T1358A	probably benign	Het
Pomgnt1	T	C	4: 116,155,967	S423P	probably damaging	Het
Pqlc3	T	A	12: 16,995,628	I114F	possibly damaging	Het
Prep	G	A	10: 45,097,437	V214I	probably benign	Het
Ptger1	T	C	8: 83,668,332		probably null	Het
Pus7	C	T	5: 23,748,834	G415D	probably benign	Het
Rbm44	C	T	1: 91,168,738	P940S	probably damaging	Het
Ripor1	A	T	8: 105,617,515	D427V	probably damaging	Het
Rp1	A	G	1: 4,345,237	I1884T	probably damaging	Het
Serinc2	T	C	4: 130,278,479	R7G	probably benign	Het
Serpina6	A	C	12: 103,654,460	F10C	possibly damaging	Het
Skint5	T	A	4: 113,688,706		probably null	Het
Slc6a4	A	T	11: 77,023,255	I544F	possibly damaging	Het
Spdye4b	T	C	5: 143,202,421	M223T	probably benign	Het
Tbc1d17	A	T	7: 44,848,331	V39D	probably damaging	Het
Thbs3	T	A	3: 89,219,463	Y295N	probably damaging	Het
Themis	G	A	10: 28,781,891	E152K	possibly damaging	Het
Tmem131	A	T	1: 36,799,338	I1502N	probably benign	Het
Tmem43	T	A	6: 91,477,354	M41K	probably benign	Het
Tmprss6	A	C	15: 78,440,303	W771G	probably damaging	Het
Trp53tg5	T	C	2: 164,471,336	T140A	probably benign	Het
Uchl1	A	G	5: 66,686,873	E206G	probably damaging	Het
Vash2	A	G	1: 190,960,291	V229A	possibly damaging	Het
Vmn1r192	C	A	13: 22,187,214	A279S	possibly damaging	Het
Vmn1r32	T	C	6: 66,553,172	R207G	probably damaging	Het
Vmn2r14	T	A	5: 109,220,395	M244L	probably benign	Het
Vwa5b2	T	A	16: 20,595,339	H236Q	probably damaging	Het
Zfp652	C	T	11: 95,749,290	P14S	probably benign	Het
Zfp668	G	A	7: 127,867,823	R194*	probably null	Het
Zgrf1	G	T	3: 127,561,025	V98L	probably benign	Het

Other mutations in Enpp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00519:Enpp3	APN	10	24787772	missense	probably benign	0.00
IGL00778:Enpp3	APN	10	24798262	missense	probably damaging	1.00
IGL01147:Enpp3	APN	10	24774907	missense	probably damaging	1.00
IGL01343:Enpp3	APN	10	24805922	nonsense	probably null
IGL01642:Enpp3	APN	10	24798269	missense	probably damaging	1.00
IGL01814:Enpp3	APN	10	24792025	missense	possibly damaging	0.68
IGL02083:Enpp3	APN	10	24776794	missense	probably damaging	1.00
IGL02152:Enpp3	APN	10	24774002	missense	probably damaging	1.00
IGL02186:Enpp3	APN	10	24791983	splice site	probably benign
IGL02517:Enpp3	APN	10	24809848	splice site	probably benign
IGL02956:Enpp3	APN	10	24774943	splice site	probably benign
R0017:Enpp3	UTSW	10	24799153	splice site	probably null
R0042:Enpp3	UTSW	10	24774824	missense	probably damaging	1.00
R0110:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0218:Enpp3	UTSW	10	24776869	missense	possibly damaging	0.80
R0403:Enpp3	UTSW	10	24804436	missense	probably damaging	1.00
R0433:Enpp3	UTSW	10	24820597	missense	probably benign	0.00
R0450:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0510:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0826:Enpp3	UTSW	10	24795716	missense	probably damaging	1.00
R1245:Enpp3	UTSW	10	24784953	splice site	probably benign
R1261:Enpp3	UTSW	10	24774934	missense	probably damaging	0.97
R1633:Enpp3	UTSW	10	24795782	missense	probably damaging	1.00
R1903:Enpp3	UTSW	10	24778789	missense	probably damaging	1.00
R1913:Enpp3	UTSW	10	24776771	nonsense	probably null
R1966:Enpp3	UTSW	10	24807491	missense	probably damaging	0.99
R2157:Enpp3	UTSW	10	24776878	missense	probably damaging	1.00
R2179:Enpp3	UTSW	10	24805895	missense	probably benign	0.00
R2380:Enpp3	UTSW	10	24776872	missense	probably benign
R2410:Enpp3	UTSW	10	24774818	missense	probably benign	0.00
R3794:Enpp3	UTSW	10	24831732	splice site	probably null
R3896:Enpp3	UTSW	10	24777949	missense	possibly damaging	0.79
R4334:Enpp3	UTSW	10	24793589	missense	probably damaging	1.00
R4569:Enpp3	UTSW	10	24776882	missense	probably damaging	1.00
R4766:Enpp3	UTSW	10	24773927	missense	probably damaging	1.00
R4951:Enpp3	UTSW	10	24798277	missense	probably damaging	1.00
R4998:Enpp3	UTSW	10	24807538	missense	probably benign	0.01
R5045:Enpp3	UTSW	10	24776767	missense	probably damaging	1.00
R5276:Enpp3	UTSW	10	24809916	missense	probably damaging	1.00
R5331:Enpp3	UTSW	10	24808160	missense	probably damaging	1.00
R5975:Enpp3	UTSW	10	24774842	missense	probably benign	0.37
R6117:Enpp3	UTSW	10	24787852	missense	probably damaging	1.00
R6419:Enpp3	UTSW	10	24808191	missense	probably damaging	1.00
R6677:Enpp3	UTSW	10	24777957	missense	possibly damaging	0.88
R6735:Enpp3	UTSW	10	24807453	missense	probably damaging	1.00
R6833:Enpp3	UTSW	10	24809870	missense	probably damaging	1.00
R6999:Enpp3	UTSW	10	24808166	missense	probably damaging	1.00
R7022:Enpp3	UTSW	10	24826195	missense	probably damaging	0.99
R7173:Enpp3	UTSW	10	24774047	missense	probably damaging	1.00
R7224:Enpp3	UTSW	10	24776884	missense	possibly damaging	0.63
R7227:Enpp3	UTSW	10	24817844	missense	unknown
R7487:Enpp3	UTSW	10	24805923	missense	probably benign	0.02
R7529:Enpp3	UTSW	10	24798174	missense	probably damaging	0.97
R7583:Enpp3	UTSW	10	24836092	start codon destroyed	probably null	0.83
R7692:Enpp3	UTSW	10	24784841	nonsense	probably null
R7962:Enpp3	UTSW	10	24784854	missense	probably damaging	1.00
R7965:Enpp3	UTSW	10	24778819	missense	possibly damaging	0.90
R8153:Enpp3	UTSW	10	24809879	missense	probably damaging	1.00
R8262:Enpp3	UTSW	10	24777926	missense	probably damaging	1.00
R8305:Enpp3	UTSW	10	24824929	critical splice acceptor site	probably null
R8393:Enpp3	UTSW	10	24826241	missense	probably damaging	1.00
R8776:Enpp3	UTSW	10	24774835	missense	probably damaging	1.00
R8776-TAIL:Enpp3	UTSW	10	24774835	missense	probably damaging	1.00
R8962:Enpp3	UTSW	10	24820615	missense	probably benign	0.12
R9047:Enpp3	UTSW	10	24798274	missense	possibly damaging	0.83
R9093:Enpp3	UTSW	10	24795804	missense	probably benign	0.00
R9117:Enpp3	UTSW	10	24826180	missense	possibly damaging	0.67
R9194:Enpp3	UTSW	10	24799194	missense	possibly damaging	0.90
R9224:Enpp3	UTSW	10	24774818	missense	probably benign	0.00
R9244:Enpp3	UTSW	10	24778791	missense	probably damaging	1.00
R9387:Enpp3	UTSW	10	24836092	start codon destroyed	probably null	0.83
R9644:Enpp3	UTSW	10	24809903	missense	probably damaging	0.98
R9658:Enpp3	UTSW	10	24773904	makesense	probably null
X0026:Enpp3	UTSW	10	24826242	missense	probably damaging	1.00
Z1176:Enpp3	UTSW	10	24787793	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATGTTTAACGCACACGCCAC -3'
(R):5'- AGGTATATTTGATGTGTCCTCCC -3'

Sequencing Primer
(F):5'- ACATCCGCGGACTGAGG -3'
(R):5'- GTATATTTGATGTGTCCTCCCAACCC -3'

Posted On

2016-10-24