Incidental Mutation 'R5802:Tmem129'
ID 448778
Institutional Source Beutler Lab
Gene Symbol Tmem129
Ensembl Gene ENSMUSG00000019295
Gene Name transmembrane protein 129
Synonyms 0610039G24Rik, 2410015J15Rik
MMRRC Submission 043391-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5802 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 33810560-33815321 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 33815060 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 38 (S38P)
Ref Sequence ENSEMBL: ENSMUSP00000019439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019439] [ENSMUST00000074849] [ENSMUST00000079534] [ENSMUST00000114426] [ENSMUST00000152847] [ENSMUST00000200849] [ENSMUST00000201633]
AlphaFold Q8K304
Predicted Effect probably damaging
Transcript: ENSMUST00000019439
AA Change: S38P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000019439
Gene: ENSMUSG00000019295
AA Change: S38P

DomainStartEndE-ValueType
Pfam:Tmpp129 17 361 6.8e-146 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074849
SMART Domains Protein: ENSMUSP00000074394
Gene: ENSMUSG00000037313

DomainStartEndE-ValueType
low complexity region 127 143 N/A INTRINSIC
internal_repeat_1 144 212 2.67e-29 PROSPERO
internal_repeat_1 240 308 2.67e-29 PROSPERO
Pfam:TACC 435 631 2.6e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079534
SMART Domains Protein: ENSMUSP00000078491
Gene: ENSMUSG00000037313

DomainStartEndE-ValueType
low complexity region 127 143 N/A INTRINSIC
internal_repeat_1 144 212 2.48e-29 PROSPERO
internal_repeat_1 240 308 2.48e-29 PROSPERO
Pfam:TACC 427 629 2.1e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114426
SMART Domains Protein: ENSMUSP00000110069
Gene: ENSMUSG00000037313

DomainStartEndE-ValueType
low complexity region 127 143 N/A INTRINSIC
internal_repeat_1 144 212 2.48e-29 PROSPERO
internal_repeat_1 240 308 2.48e-29 PROSPERO
Pfam:TACC 427 629 2.1e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125527
SMART Domains Protein: ENSMUSP00000115390
Gene: ENSMUSG00000019295

DomainStartEndE-ValueType
Pfam:Tmpp129 17 71 1e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139453
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140931
SMART Domains Protein: ENSMUSP00000114809
Gene: ENSMUSG00000019295

DomainStartEndE-ValueType
Pfam:Tmpp129 17 71 1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152847
Predicted Effect probably benign
Transcript: ENSMUST00000200849
SMART Domains Protein: ENSMUSP00000144662
Gene: ENSMUSG00000019295

DomainStartEndE-ValueType
Pfam:Tmpp129 1 73 1.4e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202708
Predicted Effect probably benign
Transcript: ENSMUST00000201633
SMART Domains Protein: ENSMUSP00000144567
Gene: ENSMUSG00000037313

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
internal_repeat_1 34 102 8.87e-21 PROSPERO
internal_repeat_1 130 198 8.87e-21 PROSPERO
Meta Mutation Damage Score 0.6457 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (63/65)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A T 1: 12,021,188 (GRCm39) D383V probably damaging Het
AAdacl4fm3 T A 4: 144,430,206 (GRCm39) D261V probably damaging Het
Abca4 A T 3: 121,847,881 (GRCm39) L67F probably damaging Het
Abcc9 C A 6: 142,602,402 (GRCm39) probably null Het
Atp2a3 T C 11: 72,863,708 (GRCm39) V175A probably damaging Het
B3galt4 T A 17: 34,169,731 (GRCm39) D169V probably damaging Het
Bsn C T 9: 107,990,208 (GRCm39) R1848Q possibly damaging Het
Camkk2 T C 5: 122,872,307 (GRCm39) E90G probably damaging Het
Cdon T A 9: 35,365,716 (GRCm39) I155N probably damaging Het
Cep70 A G 9: 99,178,458 (GRCm39) N519D probably damaging Het
Clgn T C 8: 84,152,243 (GRCm39) S582P probably damaging Het
Cnga3 T C 1: 37,300,006 (GRCm39) F280S probably damaging Het
Dennd4c C T 4: 86,729,690 (GRCm39) T764M probably benign Het
Dis3 A T 14: 99,337,100 (GRCm39) S4T probably damaging Het
Dlgap1 T C 17: 71,073,086 (GRCm39) probably null Het
Dnah17 C T 11: 117,927,272 (GRCm39) V3839I possibly damaging Het
Dnajc1 A G 2: 18,289,550 (GRCm39) Y286H probably benign Het
Dynap T A 18: 70,374,073 (GRCm39) D151V unknown Het
Ednrb A G 14: 104,059,150 (GRCm39) F292S probably damaging Het
Eef1a1 A G 9: 78,386,318 (GRCm39) S396P probably damaging Het
Fancg A G 4: 43,006,582 (GRCm39) F324S probably benign Het
Fbxw11 T A 11: 32,661,790 (GRCm39) S56T probably benign Het
Gm17535 G C 9: 3,035,758 (GRCm39) V209L probably benign Homo
Gm5592 C T 7: 40,868,529 (GRCm39) probably benign Het
Gpr137 C T 19: 6,919,373 (GRCm39) W51* probably null Het
H2-T9 A G 17: 36,422,179 (GRCm39) probably benign Het
Hbb-bs T C 7: 103,475,879 (GRCm39) Y146C probably damaging Het
Herc1 G T 9: 66,370,160 (GRCm39) C2982F probably damaging Het
Hnrnpa3 T A 2: 75,495,400 (GRCm39) N309K unknown Het
Hydin A T 8: 111,178,692 (GRCm39) I1096F possibly damaging Het
Klf12 A G 14: 100,260,330 (GRCm39) V133A probably benign Het
Lats2 A T 14: 57,931,875 (GRCm39) Y848N probably damaging Het
Loxl3 A G 6: 83,026,270 (GRCm39) T453A possibly damaging Het
Ltn1 T G 16: 87,212,569 (GRCm39) H664P probably benign Het
Lypd6 C T 2: 50,063,613 (GRCm39) T40I probably benign Het
Nbeal1 A T 1: 60,311,380 (GRCm39) T1817S probably benign Het
Nub1 A C 5: 24,907,439 (GRCm39) Y350S possibly damaging Het
Pbp2 A G 6: 135,286,874 (GRCm39) Y158H possibly damaging Het
Ptpru C T 4: 131,515,688 (GRCm39) E827K possibly damaging Het
Rap1a A G 3: 105,653,252 (GRCm39) Y32H probably damaging Het
Raph1 T C 1: 60,527,832 (GRCm39) N1143S possibly damaging Het
Rbl1 T C 2: 157,003,353 (GRCm39) T859A probably benign Het
Rom1 A G 19: 8,906,188 (GRCm39) L117P probably damaging Het
Senp6 T C 9: 80,025,926 (GRCm39) probably benign Het
Sirpb1c T C 3: 15,886,240 (GRCm39) M379V probably benign Het
Slc6a4 C T 11: 76,910,062 (GRCm39) T439M probably damaging Het
Srsf12 G T 4: 33,230,929 (GRCm39) R141L probably damaging Het
Stk10 C T 11: 32,546,748 (GRCm39) P335L probably benign Het
Tcstv2c G A 13: 120,616,449 (GRCm39) S96N possibly damaging Het
Tecpr1 A T 5: 144,143,364 (GRCm39) N670K probably benign Het
Tgds T C 14: 118,370,119 (GRCm39) E8G probably benign Het
Trappc9 T C 15: 72,557,188 (GRCm39) E812G probably damaging Het
Trmt10b T A 4: 45,314,236 (GRCm39) probably benign Het
Wapl A G 14: 34,414,277 (GRCm39) T380A probably damaging Het
Xylt1 A T 7: 117,255,914 (GRCm39) T829S probably benign Het
Zc3h6 C T 2: 128,857,479 (GRCm39) P666L possibly damaging Het
Zfp1010 T C 2: 176,957,049 (GRCm39) T150A possibly damaging Het
Zfp703 C T 8: 27,469,233 (GRCm39) P299L probably damaging Het
Other mutations in Tmem129
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03048:Tmem129 UTSW 5 33,812,811 (GRCm39) missense possibly damaging 0.90
R0336:Tmem129 UTSW 5 33,812,946 (GRCm39) missense probably damaging 1.00
R0972:Tmem129 UTSW 5 33,812,112 (GRCm39) missense possibly damaging 0.63
R1559:Tmem129 UTSW 5 33,815,100 (GRCm39) splice site probably null
R1869:Tmem129 UTSW 5 33,811,843 (GRCm39) missense probably damaging 1.00
R1967:Tmem129 UTSW 5 33,812,665 (GRCm39) critical splice donor site probably null
R2050:Tmem129 UTSW 5 33,815,126 (GRCm39) missense probably benign 0.00
R5208:Tmem129 UTSW 5 33,812,850 (GRCm39) missense probably damaging 1.00
R7744:Tmem129 UTSW 5 33,811,732 (GRCm39) missense probably damaging 1.00
R8537:Tmem129 UTSW 5 33,812,920 (GRCm39) missense possibly damaging 0.65
R8859:Tmem129 UTSW 5 33,811,837 (GRCm39) missense probably benign 0.12
R9495:Tmem129 UTSW 5 33,815,122 (GRCm39) missense probably benign 0.02
R9514:Tmem129 UTSW 5 33,815,122 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CATGATCTTGACCGGCTTCTGC -3'
(R):5'- TTGGACTCCGTTTCCCAGAG -3'

Sequencing Primer
(F):5'- TGACCGGCTTCTGCTCCAG -3'
(R):5'- TGGCTGCGGCAACAAAC -3'
Posted On 2016-12-15