Incidental Mutation 'R5802:Clgn'
ID448788
Institutional Source Beutler Lab
Gene Symbol Clgn
Ensembl Gene ENSMUSG00000002190
Gene Namecalmegin
Synonyms4930459O04Rik, A2/6, Cln, calnexin-t
MMRRC Submission 043391-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.390) question?
Stock #R5802 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location83389867-83428552 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83425614 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 582 (S582P)
Ref Sequence ENSEMBL: ENSMUSP00000105457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002259] [ENSMUST00000109831] [ENSMUST00000212449]
Predicted Effect probably damaging
Transcript: ENSMUST00000002259
AA Change: S582P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002259
Gene: ENSMUSG00000002190
AA Change: S582P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Calreticulin 62 429 6.6e-160 PFAM
transmembrane domain 471 493 N/A INTRINSIC
low complexity region 516 533 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109831
AA Change: S582P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105457
Gene: ENSMUSG00000002190
AA Change: S582P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Calreticulin 60 429 1.9e-154 PFAM
transmembrane domain 471 493 N/A INTRINSIC
low complexity region 516 533 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212449
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212473
Meta Mutation Damage Score 0.0746 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: This gene belongs to the calreticulin family, which includes calreticulin, calnexin, and calmegin, and encodes a calcium-binding molecular chaperone specifically expressed in pachytene stage male germ cells. It is required for the proper folding of newly synthesized membrane proteins in the endoplasmic reticulum including those critical for sperm migration from the uterus into the oviduct and sperm adhesion to and penetration of the zona pellucida. This gene plays a key role in spermatogenesis and male infertility. Alternative splice variants exist for this gene. [provided by RefSeq, Jul 2016]
PHENOTYPE: Males homozygous for a targeted null mutation exhibit severely impaired fertility associated with an apparent defect in either sperm/zona pellucida binding and/or sperm transit to the oviduct. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A T 1: 11,950,964 D383V probably damaging Het
Abca4 A T 3: 122,054,232 L67F probably damaging Het
Abcc9 C A 6: 142,656,676 probably null Het
Atp2a3 T C 11: 72,972,882 V175A probably damaging Het
B3galt4 T A 17: 33,950,757 D169V probably damaging Het
Bsn C T 9: 108,113,009 R1848Q possibly damaging Het
Camkk2 T C 5: 122,734,244 E90G probably damaging Het
Cdon T A 9: 35,454,420 I155N probably damaging Het
Cep70 A G 9: 99,296,405 N519D probably damaging Het
Cnga3 T C 1: 37,260,925 F280S probably damaging Het
Dennd4c C T 4: 86,811,453 T764M probably benign Het
Dis3 A T 14: 99,099,664 S4T probably damaging Het
Dlgap1 T C 17: 70,766,091 probably null Het
Dnah17 C T 11: 118,036,446 V3839I possibly damaging Het
Dnajc1 A G 2: 18,284,739 Y286H probably benign Het
Dynap T A 18: 70,241,002 D151V unknown Het
Ednrb A G 14: 103,821,714 F292S probably damaging Het
Eef1a1 A G 9: 78,479,036 S396P probably damaging Het
Fancg A G 4: 43,006,582 F324S probably benign Het
Fbxw11 T A 11: 32,711,790 S56T probably benign Het
Gm13178 T A 4: 144,703,636 D261V probably damaging Het
Gm14409 T C 2: 177,265,256 T150A possibly damaging Het
Gm17535 G C 9: 3,035,758 V209L probably benign Homo
Gm20767 G A 13: 120,154,913 S96N possibly damaging Het
Gm5592 C T 7: 41,219,105 probably benign Het
Gm7030 A G 17: 36,111,287 probably benign Het
Gpr137 C T 19: 6,942,005 W51* probably null Het
Hbb-bs T C 7: 103,826,672 Y146C probably damaging Het
Herc1 G T 9: 66,462,878 C2982F probably damaging Het
Hnrnpa3 T A 2: 75,665,056 N309K unknown Het
Hydin A T 8: 110,452,060 I1096F possibly damaging Het
Klf12 A G 14: 100,022,894 V133A probably benign Het
Lats2 A T 14: 57,694,418 Y848N probably damaging Het
Loxl3 A G 6: 83,049,289 T453A possibly damaging Het
Ltn1 T G 16: 87,415,681 H664P probably benign Het
Lypd6 C T 2: 50,173,601 T40I probably benign Het
Nbeal1 A T 1: 60,272,221 T1817S probably benign Het
Nub1 A C 5: 24,702,441 Y350S possibly damaging Het
Pbp2 A G 6: 135,309,876 Y158H possibly damaging Het
Ptpru C T 4: 131,788,377 E827K possibly damaging Het
Rap1a A G 3: 105,745,936 Y32H probably damaging Het
Raph1 T C 1: 60,488,673 N1143S possibly damaging Het
Rbl1 T C 2: 157,161,433 T859A probably benign Het
Rom1 A G 19: 8,928,824 L117P probably damaging Het
Senp6 T C 9: 80,118,644 probably benign Het
Sirpb1c T C 3: 15,832,076 M379V probably benign Het
Slc6a4 C T 11: 77,019,236 T439M probably damaging Het
Srsf12 G T 4: 33,230,929 R141L probably damaging Het
Stk10 C T 11: 32,596,748 P335L probably benign Het
Tecpr1 A T 5: 144,206,546 N670K probably benign Het
Tgds T C 14: 118,132,707 E8G probably benign Het
Tmem129 A G 5: 33,657,716 S38P probably damaging Het
Trappc9 T C 15: 72,685,339 E812G probably damaging Het
Trmt10b T A 4: 45,314,236 probably benign Het
Wapl A G 14: 34,692,320 T380A probably damaging Het
Xylt1 A T 7: 117,656,691 T829S probably benign Het
Zc3h6 C T 2: 129,015,559 P666L possibly damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Clgn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01729:Clgn APN 8 83397650 missense probably damaging 1.00
IGL02158:Clgn APN 8 83423136 missense probably damaging 1.00
IGL03077:Clgn APN 8 83424140 missense probably benign 0.05
PIT4260001:Clgn UTSW 8 83423124 missense probably damaging 0.99
R0604:Clgn UTSW 8 83424194 missense probably benign 0.01
R1728:Clgn UTSW 8 83423030 missense probably damaging 0.98
R1729:Clgn UTSW 8 83423030 missense probably damaging 0.98
R2059:Clgn UTSW 8 83399978 missense probably benign 0.01
R2182:Clgn UTSW 8 83410410 missense possibly damaging 0.80
R3821:Clgn UTSW 8 83420477 missense probably null 0.02
R4542:Clgn UTSW 8 83420209 missense probably damaging 1.00
R5097:Clgn UTSW 8 83410523 missense possibly damaging 0.90
R5677:Clgn UTSW 8 83409538 missense probably damaging 1.00
R5752:Clgn UTSW 8 83397041 missense probably damaging 0.99
R6584:Clgn UTSW 8 83400036 missense probably benign 0.33
R7542:Clgn UTSW 8 83395545 missense possibly damaging 0.90
R7563:Clgn UTSW 8 83420556 missense probably damaging 1.00
R7819:Clgn UTSW 8 83408200 missense possibly damaging 0.87
RF022:Clgn UTSW 8 83425606 missense probably damaging 1.00
Z1177:Clgn UTSW 8 83397681 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TTCTGCACTGTCCAGCACTG -3'
(R):5'- TTTCACCAGTGCAGTCTACC -3'

Sequencing Primer
(F):5'- ACTGCGCGTGTGCAAAC -3'
(R):5'- AGTGCAGTCTACCTTTACATTGTG -3'
Posted On2016-12-15