Incidental Mutation 'R0471:Rusc2'
ID46743
Institutional Source Beutler Lab
Gene Symbol Rusc2
Ensembl Gene ENSMUSG00000035969
Gene NameRUN and SH3 domain containing 2
Synonyms
MMRRC Submission 038671-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R0471 (G1)
Quality Score113
Status Validated
Chromosome4
Chromosomal Location43381979-43427088 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 43425486 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 1197 (R1197L)
Ref Sequence ENSEMBL: ENSMUSP00000095710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035645] [ENSMUST00000052829] [ENSMUST00000098106] [ENSMUST00000107928] [ENSMUST00000107929] [ENSMUST00000131668] [ENSMUST00000149221] [ENSMUST00000149676] [ENSMUST00000171134] [ENSMUST00000173682]
Predicted Effect probably damaging
Transcript: ENSMUST00000035645
AA Change: R1197L

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038379
Gene: ENSMUSG00000035969
AA Change: R1197L

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 600 617 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
RUN 1109 1177 3.66e-21 SMART
low complexity region 1235 1260 N/A INTRINSIC
low complexity region 1289 1324 N/A INTRINSIC
low complexity region 1330 1341 N/A INTRINSIC
SH3 1457 1512 7.4e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000052829
SMART Domains Protein: ENSMUSP00000058980
Gene: ENSMUSG00000042788

DomainStartEndE-ValueType
Pfam:DUF2475 15 47 2.9e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098106
AA Change: R1197L

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095710
Gene: ENSMUSG00000035969
AA Change: R1197L

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 600 617 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
RUN 1109 1177 3.66e-21 SMART
low complexity region 1235 1260 N/A INTRINSIC
low complexity region 1289 1324 N/A INTRINSIC
low complexity region 1330 1341 N/A INTRINSIC
SH3 1457 1512 7.4e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107928
SMART Domains Protein: ENSMUSP00000103561
Gene: ENSMUSG00000042788

DomainStartEndE-ValueType
Pfam:DUF2475 15 76 1.3e-20 PFAM
Pfam:DUF2475 212 251 6.9e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107929
SMART Domains Protein: ENSMUSP00000103562
Gene: ENSMUSG00000042788

DomainStartEndE-ValueType
Pfam:DUF2475 15 76 1.5e-20 PFAM
Pfam:DUF2475 232 271 7.7e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125393
Predicted Effect probably damaging
Transcript: ENSMUST00000131668
AA Change: R1197L

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118528
Gene: ENSMUSG00000035969
AA Change: R1197L

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 600 617 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
RUN 1109 1177 3.66e-21 SMART
low complexity region 1235 1260 N/A INTRINSIC
low complexity region 1289 1324 N/A INTRINSIC
low complexity region 1330 1341 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146710
Predicted Effect probably benign
Transcript: ENSMUST00000149221
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149556
Predicted Effect probably benign
Transcript: ENSMUST00000149676
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150066
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154754
Predicted Effect probably benign
Transcript: ENSMUST00000155080
Predicted Effect probably benign
Transcript: ENSMUST00000171134
SMART Domains Protein: ENSMUSP00000127145
Gene: ENSMUSG00000042788

DomainStartEndE-ValueType
Pfam:DUF2475 15 76 7.2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173682
SMART Domains Protein: ENSMUSP00000133715
Gene: ENSMUSG00000035969

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 685 703 N/A INTRINSIC
low complexity region 733 740 N/A INTRINSIC
Meta Mutation Damage Score 0.1758 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a RUN and SH3 domain containing protein that interacts with Rab1b and Rab1-binding protein GM130. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik G A 4: 35,193,257 T232I probably benign Het
Acp6 T C 3: 97,168,575 probably null Het
Adam33 C A 2: 131,054,479 G437C probably damaging Het
Aldh1a1 T A 19: 20,602,013 M1K probably null Het
Amotl2 C A 9: 102,720,519 P126Q probably damaging Het
Ap1g1 T A 8: 109,853,643 M576K possibly damaging Het
Apob C A 12: 7,990,406 A581E probably damaging Het
Asb7 A T 7: 66,679,159 D44E probably damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Ccdc65 A T 15: 98,717,467 H118L probably benign Het
Cdc25b A G 2: 131,197,284 E523G probably damaging Het
Cdk11b A G 4: 155,647,542 probably benign Het
Clec1b A G 6: 129,401,607 probably benign Het
Cntrl A G 2: 35,127,380 T400A probably benign Het
Cpne4 T G 9: 105,022,282 probably null Het
Cyp2j6 T A 4: 96,531,748 R249* probably null Het
Dock2 T C 11: 34,688,553 I678V probably benign Het
Dqx1 C T 6: 83,059,426 probably benign Het
Dsp A T 13: 38,193,350 K1704* probably null Het
Eif2b2 T C 12: 85,220,183 F121S probably benign Het
Ephx4 T C 5: 107,413,513 V69A possibly damaging Het
Epn2 T C 11: 61,535,308 Q281R probably damaging Het
Fgf3 A C 7: 144,842,810 D187A probably damaging Het
Galnt18 C A 7: 111,779,299 probably benign Het
Gm4871 C T 5: 145,031,592 probably benign Het
Ick G T 9: 78,155,517 probably null Het
Inpp4b T C 8: 82,041,899 I679T possibly damaging Het
Itpkb A G 1: 180,418,255 E779G probably damaging Het
Itsn1 G A 16: 91,899,589 V27M probably damaging Het
Lrp2 C A 2: 69,525,234 R422L probably damaging Het
Mmp25 G A 17: 23,639,884 A231V possibly damaging Het
Mprip T C 11: 59,759,735 S1422P probably damaging Het
Mro A T 18: 73,876,789 Q176L probably benign Het
Mrpl12 A G 11: 120,488,403 E192G probably damaging Het
Myo5b A T 18: 74,728,954 probably benign Het
Ncam2 G T 16: 81,200,884 probably benign Het
Nip7 T C 8: 107,057,317 L63P probably damaging Het
Nsd3 T C 8: 25,648,434 probably benign Het
Nup98 A T 7: 102,138,797 V1022D probably benign Het
Olfr1173 A G 2: 88,274,215 V278A possibly damaging Het
Olfr1391 T A 11: 49,327,917 C169S probably damaging Het
Olfr190 A G 16: 59,074,270 I270T probably benign Het
Olfr846 A T 9: 19,360,881 L158* probably null Het
P4ha2 T C 11: 54,117,608 Y214H possibly damaging Het
Pacrg A T 17: 10,576,478 F184L possibly damaging Het
Parpbp T A 10: 88,093,707 R426S probably damaging Het
Pcdhb5 T A 18: 37,321,306 Y246* probably null Het
Pik3cg T A 12: 32,194,771 T895S probably damaging Het
Prkch T C 12: 73,691,652 Y178H probably benign Het
Svep1 T C 4: 58,054,700 E3296G possibly damaging Het
Svs3a A G 2: 164,289,881 K123R probably benign Het
Sycp2l A G 13: 41,150,530 probably null Het
Syne3 T C 12: 104,943,426 H717R probably benign Het
Tiprl A G 1: 165,222,523 probably null Het
Trim24 T G 6: 37,915,195 V151G possibly damaging Het
Trim33 T C 3: 103,326,901 V56A possibly damaging Het
Trim67 C A 8: 124,794,658 T253K probably benign Het
Trip12 T C 1: 84,726,207 E698G probably damaging Het
Tspan14 T C 14: 40,915,396 D145G probably damaging Het
Ushbp1 G A 8: 71,394,377 Q204* probably null Het
Vmn1r71 G C 7: 10,748,092 S223C possibly damaging Het
Vmn2r75 G T 7: 86,165,513 N257K probably benign Het
Washc4 T C 10: 83,558,734 probably benign Het
Zc3h7b G A 15: 81,781,968 D560N probably damaging Het
Zscan21 T C 5: 138,125,140 V27A probably benign Het
Zzef1 A C 11: 72,923,111 E2842A probably damaging Het
Other mutations in Rusc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Rusc2 APN 4 43426116 missense probably damaging 0.97
IGL01474:Rusc2 APN 4 43416434 missense probably damaging 0.98
IGL01541:Rusc2 APN 4 43415840 missense probably benign 0.08
IGL01628:Rusc2 APN 4 43425729 missense probably damaging 1.00
IGL01969:Rusc2 APN 4 43415738 missense probably benign 0.02
IGL02030:Rusc2 APN 4 43416095 missense possibly damaging 0.86
IGL02079:Rusc2 APN 4 43425668 missense probably benign
IGL02115:Rusc2 APN 4 43426136 splice site probably benign
IGL02122:Rusc2 APN 4 43421685 missense possibly damaging 0.67
IGL02350:Rusc2 APN 4 43425351 missense possibly damaging 0.86
IGL02357:Rusc2 APN 4 43425351 missense possibly damaging 0.86
IGL02437:Rusc2 APN 4 43415545 missense probably damaging 1.00
IGL02930:Rusc2 APN 4 43416376 missense probably damaging 0.99
IGL03154:Rusc2 APN 4 43425806 missense probably benign 0.00
P0026:Rusc2 UTSW 4 43415840 missense possibly damaging 0.93
R0036:Rusc2 UTSW 4 43424009 missense probably damaging 1.00
R0068:Rusc2 UTSW 4 43424100 splice site probably benign
R0068:Rusc2 UTSW 4 43424100 splice site probably benign
R0114:Rusc2 UTSW 4 43422055 missense probably damaging 1.00
R0255:Rusc2 UTSW 4 43423954 missense probably damaging 1.00
R1381:Rusc2 UTSW 4 43416137 missense probably damaging 1.00
R1413:Rusc2 UTSW 4 43416568 missense probably benign 0.00
R1416:Rusc2 UTSW 4 43421617 missense possibly damaging 0.86
R1731:Rusc2 UTSW 4 43426046 missense probably benign
R1864:Rusc2 UTSW 4 43421719 missense possibly damaging 0.49
R1897:Rusc2 UTSW 4 43421749 missense probably damaging 1.00
R2010:Rusc2 UTSW 4 43415212 missense probably benign 0.06
R2212:Rusc2 UTSW 4 43415935 missense probably damaging 1.00
R2275:Rusc2 UTSW 4 43416260 missense probably damaging 1.00
R2885:Rusc2 UTSW 4 43415456 missense probably benign 0.28
R2886:Rusc2 UTSW 4 43415456 missense probably benign 0.28
R3412:Rusc2 UTSW 4 43415935 missense probably damaging 1.00
R3413:Rusc2 UTSW 4 43415935 missense probably damaging 1.00
R3414:Rusc2 UTSW 4 43415935 missense probably damaging 1.00
R3852:Rusc2 UTSW 4 43416424 missense probably benign 0.45
R4135:Rusc2 UTSW 4 43425563 missense possibly damaging 0.49
R4272:Rusc2 UTSW 4 43415533 missense probably damaging 1.00
R4574:Rusc2 UTSW 4 43416080 missense probably damaging 0.99
R4888:Rusc2 UTSW 4 43423942 missense probably damaging 1.00
R5010:Rusc2 UTSW 4 43415926 missense probably damaging 1.00
R5071:Rusc2 UTSW 4 43415240 missense probably benign 0.05
R5131:Rusc2 UTSW 4 43414948 missense probably benign 0.03
R5177:Rusc2 UTSW 4 43421805 unclassified probably null
R5540:Rusc2 UTSW 4 43423975 missense probably damaging 1.00
R5561:Rusc2 UTSW 4 43415932 nonsense probably null
R5628:Rusc2 UTSW 4 43425348 missense probably damaging 1.00
R5645:Rusc2 UTSW 4 43425758 missense probably benign 0.06
R6129:Rusc2 UTSW 4 43424271 missense probably damaging 1.00
R6362:Rusc2 UTSW 4 43416416 missense probably benign 0.30
R6633:Rusc2 UTSW 4 43414852 missense probably damaging 0.99
R6980:Rusc2 UTSW 4 43422846 missense probably benign 0.35
R7491:Rusc2 UTSW 4 43426528 missense probably damaging 1.00
R7641:Rusc2 UTSW 4 43425335 missense possibly damaging 0.84
R7698:Rusc2 UTSW 4 43414900 nonsense probably null
R7710:Rusc2 UTSW 4 43416119 missense probably benign 0.07
X0025:Rusc2 UTSW 4 43422226 missense probably benign 0.00
X0066:Rusc2 UTSW 4 43422204 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGCAAACGAAAGCAATGTCCACAG -3'
(R):5'- TGCGAGGGAATCTAGAGCCCTCAG -3'

Sequencing Primer
(F):5'- TCTCAGGCCAGATTAGACTCG -3'
(R):5'- ACTTGCCATGATCCGAGC -3'
Posted On2013-06-11