Mutagenetix > Incidental Mutation

Incidental Mutation 'R6129:Plxnd1'

487566

Institutional Source

Beutler Lab

Gene Symbol

Plxnd1

Ensembl Gene

ENSMUSG00000030123

Gene Name

plexin D1

Synonyms

6230425C21Rik, b2b1863Clo, b2b553Clo

MMRRC Submission

044276-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6129 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

115931772-115971966 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 115955135 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 571 (C571R)

Ref Sequence

ENSEMBL: ENSMUSP00000015511 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015511]

AlphaFold

Q3UH93

Predicted Effect

probably damaging
Transcript: ENSMUST00000015511
AA Change: C571R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000015511
Gene: ENSMUSG00000030123
AA Change: C571R

Domain	Start	End	E-Value	Type
signal peptide	1	48	N/A	INTRINSIC
Sema	61	531	6.52e-90	SMART
PSI	550	603	6.06e-12	SMART
PSI	703	755	1.06e-2	SMART
Blast:PSI	850	891	9e-20	BLAST
IPT	892	981	4.43e-20	SMART
IPT	982	1068	6.61e-19	SMART
IPT	1070	1149	6.13e-14	SMART
transmembrane domain	1271	1293	N/A	INTRINSIC
Pfam:Plexin_cytopl	1345	1888	5e-238	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.8%

Validation Efficiency

100% (54/54)

MGI Phenotype

PHENOTYPE: Homozygous null mice display neonatal lethality, thin-walled atria, and vascular abnormalities including abnormal branchial arch artery development, cardiac outflow tract abnormalities, and reduced vascular smooth muscle around some vessels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810408A11Rik	T	A	11: 69,789,137 (GRCm39)	Y354F	probably damaging	Het
Aatk	C	T	11: 119,912,359 (GRCm39)	G29S	probably damaging	Het
Acsm2	G	A	7: 119,190,470 (GRCm39)		probably null	Het
Adgrl1	A	G	8: 84,645,616 (GRCm39)	N80D	probably damaging	Het
Ankrd34a	T	A	3: 96,505,274 (GRCm39)	Y159*	probably null	Het
Bcl2l2	G	A	14: 55,122,202 (GRCm39)	V122M	possibly damaging	Het
Brms1l	A	G	12: 55,914,970 (GRCm39)	H293R	probably benign	Het
Ccn1	T	C	3: 145,354,986 (GRCm39)	I90V	possibly damaging	Het
Clec4b1	A	G	6: 123,045,461 (GRCm39)	T94A	possibly damaging	Het
Crim1	A	G	17: 78,588,738 (GRCm39)	D271G	probably benign	Het
Csmd2	G	A	4: 128,387,127 (GRCm39)	G2141S	possibly damaging	Het
Cspg4b	T	A	13: 113,505,340 (GRCm39)	Y2156*	probably null	Het
Ctnnal1	C	A	4: 56,829,573 (GRCm39)	A419S	possibly damaging	Het
Cyp27a1	G	A	1: 74,774,851 (GRCm39)	R264H	probably benign	Het
Dnase1l1	C	T	X: 73,320,644 (GRCm39)		probably null	Het
Dsc2	T	A	18: 20,178,487 (GRCm39)	T306S	possibly damaging	Het
Eml2	G	A	7: 18,935,088 (GRCm39)	V432I	probably damaging	Het
Ermp1	A	T	19: 29,600,609 (GRCm39)	Y586N	possibly damaging	Het
Fbxo6	A	T	4: 148,233,979 (GRCm39)	I39N	probably damaging	Het
Gm10549	C	A	18: 33,597,358 (GRCm39)		probably benign	Het
Gm5114	C	T	7: 39,058,024 (GRCm39)	A532T	possibly damaging	Het
Gm5431	A	G	11: 48,780,418 (GRCm39)	L168P	probably damaging	Het
Hao2	T	C	3: 98,787,842 (GRCm39)	T196A	probably benign	Het
Hdac9	A	C	12: 34,337,474 (GRCm39)	L669R	probably damaging	Het
Hps5	A	G	7: 46,421,198 (GRCm39)	V755A	probably benign	Het
Jag2	G	T	12: 112,883,969 (GRCm39)	Y203*	probably null	Het
Lrrn3	G	A	12: 41,503,787 (GRCm39)	Q177*	probably null	Het
Me1	A	T	9: 86,533,009 (GRCm39)	V151E	probably damaging	Het
Mkx	A	G	18: 6,992,888 (GRCm39)	V132A	probably damaging	Het
Mycbp2	A	G	14: 103,522,836 (GRCm39)	S643P	probably benign	Het
Mysm1	C	A	4: 94,856,192 (GRCm39)	R135L	probably damaging	Het
Nup210l	T	C	3: 90,011,483 (GRCm39)	F4L	probably benign	Het
Pappa2	A	T	1: 158,542,567 (GRCm39)	C1773*	probably null	Het
Pcbp3	T	C	10: 76,599,182 (GRCm39)	E318G	probably damaging	Het
Pcdh12	T	C	18: 38,410,912 (GRCm39)	K984E	probably damaging	Het
Pcna-ps2	A	G	19: 9,261,379 (GRCm39)	N213D	possibly damaging	Het
Pde8b	G	A	13: 95,178,467 (GRCm39)	A509V	probably damaging	Het
Peg10	GAT	GATCAT	6: 4,756,449 (GRCm39)		probably benign	Het
Phf7	A	G	14: 30,962,820 (GRCm39)	Y137H	probably damaging	Het
Pkd1l1	A	G	11: 8,818,543 (GRCm39)	V1315A	probably benign	Het
Ppp1r12b	C	T	1: 134,819,990 (GRCm39)	W251*	probably null	Het
Prps1l1	A	G	12: 35,035,329 (GRCm39)	E148G	probably damaging	Het
Robo1	A	T	16: 72,809,956 (GRCm39)	M1235L	probably benign	Het
Robo3	A	G	9: 37,334,589 (GRCm39)	Y592H	probably benign	Het
Rsrc1	C	T	3: 66,901,982 (GRCm39)	P44L	unknown	Het
Rufy1	A	T	11: 50,308,075 (GRCm39)	L259Q	probably damaging	Het
Rusc2	T	C	4: 43,424,271 (GRCm39)	F1112S	probably damaging	Het
Sap130	T	C	18: 31,815,144 (GRCm39)	V622A	possibly damaging	Het
Sptbn4	C	A	7: 27,059,513 (GRCm39)	C1124F	probably damaging	Het
Stk10	T	A	11: 32,565,871 (GRCm39)	C872S	probably damaging	Het
Tex15	A	T	8: 34,064,158 (GRCm39)	N1196I	possibly damaging	Het
Tnxa	A	G	17: 35,019,262 (GRCm39)		probably benign	Het
Zfp647	G	A	15: 76,796,285 (GRCm39)	P125L	probably damaging	Het
Zscan4b	T	A	7: 10,635,815 (GRCm39)	T171S	probably benign	Het

Other mutations in Plxnd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00764:Plxnd1	APN	6	115,944,933 (GRCm39)	missense	possibly damaging	0.51
IGL01099:Plxnd1	APN	6	115,946,906 (GRCm39)	missense	probably benign
IGL01323:Plxnd1	APN	6	115,943,760 (GRCm39)	missense	possibly damaging	0.81
IGL01382:Plxnd1	APN	6	115,937,488 (GRCm39)	missense	probably damaging	1.00
IGL01786:Plxnd1	APN	6	115,936,896 (GRCm39)	missense	probably damaging	1.00
IGL02244:Plxnd1	APN	6	115,955,218 (GRCm39)	missense	probably benign	0.39
IGL02272:Plxnd1	APN	6	115,970,589 (GRCm39)	missense	probably damaging	1.00
IGL02293:Plxnd1	APN	6	115,940,874 (GRCm39)	missense	probably damaging	1.00
IGL02465:Plxnd1	APN	6	115,932,703 (GRCm39)	makesense	probably null
IGL02873:Plxnd1	APN	6	115,936,937 (GRCm39)	missense	probably damaging	1.00
IGL03209:Plxnd1	APN	6	115,939,318 (GRCm39)	missense	probably damaging	1.00
Hiss	UTSW	6	115,946,890 (GRCm39)	missense	possibly damaging	0.94
murmer	UTSW	6	115,945,754 (GRCm39)	missense	probably benign	0.00
mutter	UTSW	6	115,945,005 (GRCm39)	missense	probably benign	0.27
rattle	UTSW	6	115,936,755 (GRCm39)	missense	probably damaging	0.96
R0238:Plxnd1	UTSW	6	115,945,754 (GRCm39)	missense	probably benign	0.00
R0238:Plxnd1	UTSW	6	115,945,754 (GRCm39)	missense	probably benign	0.00
R0239:Plxnd1	UTSW	6	115,945,754 (GRCm39)	missense	probably benign	0.00
R0239:Plxnd1	UTSW	6	115,945,754 (GRCm39)	missense	probably benign	0.00
R0357:Plxnd1	UTSW	6	115,946,421 (GRCm39)	missense	probably benign	0.00
R0646:Plxnd1	UTSW	6	115,935,660 (GRCm39)	splice site	probably benign
R0648:Plxnd1	UTSW	6	115,970,962 (GRCm39)	missense	possibly damaging	0.86
R0718:Plxnd1	UTSW	6	115,943,599 (GRCm39)	missense	possibly damaging	0.68
R1116:Plxnd1	UTSW	6	115,943,966 (GRCm39)	splice site	probably null
R1292:Plxnd1	UTSW	6	115,939,644 (GRCm39)	unclassified	probably benign
R1715:Plxnd1	UTSW	6	115,945,642 (GRCm39)	missense	probably benign	0.02
R1760:Plxnd1	UTSW	6	115,944,740 (GRCm39)	missense	possibly damaging	0.95
R1799:Plxnd1	UTSW	6	115,971,018 (GRCm39)	missense	probably damaging	1.00
R1817:Plxnd1	UTSW	6	115,957,562 (GRCm39)	missense	possibly damaging	0.83
R1848:Plxnd1	UTSW	6	115,943,507 (GRCm39)	missense	probably damaging	1.00
R1851:Plxnd1	UTSW	6	115,940,875 (GRCm39)	missense	probably damaging	1.00
R1864:Plxnd1	UTSW	6	115,946,402 (GRCm39)	splice site	probably null
R1865:Plxnd1	UTSW	6	115,946,402 (GRCm39)	splice site	probably null
R1875:Plxnd1	UTSW	6	115,955,045 (GRCm39)	splice site	probably null
R1899:Plxnd1	UTSW	6	115,946,324 (GRCm39)	missense	probably benign
R1913:Plxnd1	UTSW	6	115,954,978 (GRCm39)	missense	possibly damaging	0.50
R1970:Plxnd1	UTSW	6	115,939,478 (GRCm39)	missense	probably damaging	1.00
R2007:Plxnd1	UTSW	6	115,944,216 (GRCm39)	missense	probably damaging	1.00
R2134:Plxnd1	UTSW	6	115,934,509 (GRCm39)	missense	probably damaging	1.00
R2202:Plxnd1	UTSW	6	115,939,725 (GRCm39)	missense	probably benign	0.45
R2230:Plxnd1	UTSW	6	115,941,105 (GRCm39)	missense	probably damaging	1.00
R2267:Plxnd1	UTSW	6	115,939,704 (GRCm39)	missense	probably benign	0.29
R2427:Plxnd1	UTSW	6	115,944,709 (GRCm39)	critical splice donor site	probably null
R4108:Plxnd1	UTSW	6	115,936,276 (GRCm39)	missense	probably damaging	1.00
R4233:Plxnd1	UTSW	6	115,942,914 (GRCm39)	missense	probably benign	0.30
R4280:Plxnd1	UTSW	6	115,933,056 (GRCm39)	splice site	probably null
R4280:Plxnd1	UTSW	6	115,933,055 (GRCm39)	splice site	probably benign
R4346:Plxnd1	UTSW	6	115,954,941 (GRCm39)	missense	probably benign	0.16
R4439:Plxnd1	UTSW	6	115,970,937 (GRCm39)	missense	probably damaging	0.99
R4572:Plxnd1	UTSW	6	115,932,717 (GRCm39)	missense	probably damaging	1.00
R4576:Plxnd1	UTSW	6	115,945,005 (GRCm39)	missense	probably benign	0.27
R4599:Plxnd1	UTSW	6	115,971,237 (GRCm39)	missense	probably damaging	1.00
R4614:Plxnd1	UTSW	6	115,949,486 (GRCm39)	missense	possibly damaging	0.83
R4700:Plxnd1	UTSW	6	115,935,576 (GRCm39)	missense	probably damaging	1.00
R4705:Plxnd1	UTSW	6	115,935,581 (GRCm39)	missense	probably damaging	1.00
R4806:Plxnd1	UTSW	6	115,937,816 (GRCm39)	missense	probably damaging	1.00
R4944:Plxnd1	UTSW	6	115,932,726 (GRCm39)	missense	probably damaging	1.00
R4977:Plxnd1	UTSW	6	115,971,337 (GRCm39)	missense	probably damaging	1.00
R5069:Plxnd1	UTSW	6	115,942,862 (GRCm39)	missense	probably damaging	0.98
R5155:Plxnd1	UTSW	6	115,935,949 (GRCm39)	critical splice donor site	probably null
R5460:Plxnd1	UTSW	6	115,934,609 (GRCm39)	missense	probably damaging	1.00
R5729:Plxnd1	UTSW	6	115,942,838 (GRCm39)	missense	probably damaging	1.00
R5909:Plxnd1	UTSW	6	115,945,649 (GRCm39)	missense	probably benign	0.00
R5992:Plxnd1	UTSW	6	115,944,748 (GRCm39)	critical splice acceptor site	probably null
R6254:Plxnd1	UTSW	6	115,954,921 (GRCm39)	missense	probably benign	0.01
R6273:Plxnd1	UTSW	6	115,955,453 (GRCm39)	missense	probably damaging	1.00
R6310:Plxnd1	UTSW	6	115,953,697 (GRCm39)	missense	possibly damaging	0.94
R6732:Plxnd1	UTSW	6	115,946,890 (GRCm39)	missense	possibly damaging	0.94
R6857:Plxnd1	UTSW	6	115,970,724 (GRCm39)	missense	probably benign	0.05
R7243:Plxnd1	UTSW	6	115,949,468 (GRCm39)	missense	probably benign	0.00
R7282:Plxnd1	UTSW	6	115,937,798 (GRCm39)	missense	probably damaging	1.00
R7632:Plxnd1	UTSW	6	115,953,600 (GRCm39)	missense	probably benign
R7699:Plxnd1	UTSW	6	115,936,755 (GRCm39)	missense	probably damaging	0.96
R7915:Plxnd1	UTSW	6	115,943,879 (GRCm39)	missense	probably benign	0.00
R8090:Plxnd1	UTSW	6	115,933,578 (GRCm39)	missense	probably damaging	1.00
R8382:Plxnd1	UTSW	6	115,949,433 (GRCm39)	missense	probably benign
R8507:Plxnd1	UTSW	6	115,943,866 (GRCm39)	missense	probably damaging	0.97
R8539:Plxnd1	UTSW	6	115,939,768 (GRCm39)	missense	possibly damaging	0.94
R8548:Plxnd1	UTSW	6	115,934,558 (GRCm39)	missense	probably damaging	1.00
R8963:Plxnd1	UTSW	6	115,949,506 (GRCm39)	nonsense	probably null
R9119:Plxnd1	UTSW	6	115,932,832 (GRCm39)	splice site	probably benign
R9177:Plxnd1	UTSW	6	115,943,469 (GRCm39)	missense	probably benign	0.00
R9182:Plxnd1	UTSW	6	115,970,746 (GRCm39)	missense	probably damaging	0.98
R9185:Plxnd1	UTSW	6	115,934,526 (GRCm39)	missense	probably damaging	1.00
R9226:Plxnd1	UTSW	6	115,934,524 (GRCm39)	missense	probably damaging	1.00
R9433:Plxnd1	UTSW	6	115,945,754 (GRCm39)	missense	probably benign	0.00
R9449:Plxnd1	UTSW	6	115,932,730 (GRCm39)	missense	probably damaging	1.00
R9451:Plxnd1	UTSW	6	115,940,277 (GRCm39)	missense	possibly damaging	0.72
R9599:Plxnd1	UTSW	6	115,940,274 (GRCm39)	missense	possibly damaging	0.78
R9627:Plxnd1	UTSW	6	115,940,274 (GRCm39)	missense	possibly damaging	0.78
R9644:Plxnd1	UTSW	6	115,940,274 (GRCm39)	missense	possibly damaging	0.78
R9672:Plxnd1	UTSW	6	115,940,274 (GRCm39)	missense	possibly damaging	0.78
X0024:Plxnd1	UTSW	6	115,940,271 (GRCm39)	missense	probably benign	0.02
X0026:Plxnd1	UTSW	6	115,943,745 (GRCm39)	missense	possibly damaging	0.88
Z1088:Plxnd1	UTSW	6	115,944,471 (GRCm39)	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TCAATCTCCGAGGGCAGTAC -3'
(R):5'- GCTTCAAAGAGGCTATATTTCCC -3'

Sequencing Primer
(F):5'- TCCGAGGGCAGTACTGTCATG -3'
(R):5'- GAGGCTATATTTCCCCCACATAC -3'

Posted On

2017-10-10