Incidental Mutation 'R6297:Mdga2'
ID508852
Institutional Source Beutler Lab
Gene Symbol Mdga2
Ensembl Gene ENSMUSG00000034912
Gene NameMAM domain containing glycosylphosphatidylinositol anchor 2
SynonymsAdp, 6720489L24Rik, Mamdc1, 9330209L04Rik, Mdga2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6297 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location66466060-67222549 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66506253 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 793 (Y793H)
Ref Sequence ENSEMBL: ENSMUSP00000152613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037181] [ENSMUST00000222167] [ENSMUST00000222623] [ENSMUST00000222987] [ENSMUST00000223141]
Predicted Effect probably damaging
Transcript: ENSMUST00000037181
AA Change: Y869H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046761
Gene: ENSMUSG00000034912
AA Change: Y869H

DomainStartEndE-ValueType
IGc2 122 186 1.38e-15 SMART
IG 213 307 1.79e0 SMART
IGc2 324 386 1.56e-14 SMART
IGc2 419 493 4.43e-5 SMART
low complexity region 495 507 N/A INTRINSIC
IGc2 525 591 1.97e-11 SMART
IG_like 621 687 2.5e0 SMART
Blast:FN3 707 795 4e-40 BLAST
MAM 812 990 3.4e-49 SMART
transmembrane domain 999 1021 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101379
SMART Domains Protein: ENSMUSP00000098930
Gene: ENSMUSG00000034912

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SCOP:d1cs6a1 40 72 2e-5 SMART
Blast:IG 47 72 9e-11 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000178814
AA Change: Y852H
SMART Domains Protein: ENSMUSP00000137608
Gene: ENSMUSG00000034912
AA Change: Y852H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 53 117 1.38e-15 SMART
IG 144 238 1.79e0 SMART
IGc2 255 317 1.56e-14 SMART
IGc2 350 424 4.43e-5 SMART
low complexity region 426 438 N/A INTRINSIC
IGc2 456 522 1.97e-11 SMART
IG_like 552 618 2.5e0 SMART
Blast:FN3 638 726 3e-40 BLAST
MAM 736 914 1.38e-49 SMART
transmembrane domain 923 945 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221809
Predicted Effect probably damaging
Transcript: ENSMUST00000222167
AA Change: Y800H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000222623
AA Change: Y141H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000222987
AA Change: Y141H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000223141
AA Change: Y793H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223289
Meta Mutation Damage Score 0.6135 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (45/46)
MGI Phenotype PHENOTYPE: Mice that paternally inherit an allele disrupted by transgene insertion exhibit varying degrees of abnormalities in the skull, paw, and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,132,530 V1205A probably benign Het
Adgra3 G A 5: 49,960,847 P1120S probably benign Het
Ate1 A G 7: 130,503,840 V316A probably damaging Het
Bpifa1 A G 2: 154,144,260 I102V probably benign Het
Catsperb A G 12: 101,591,396 probably null Het
Ccdc47 T C 11: 106,203,601 Y324C probably damaging Het
Cdh22 T C 2: 165,143,644 K341E possibly damaging Het
Cenpb A G 2: 131,178,369 probably benign Het
Dgkd A G 1: 87,926,144 I570V possibly damaging Het
Dhx32 A T 7: 133,742,800 Y27N probably damaging Het
Dnah10 A G 5: 124,775,080 D1824G possibly damaging Het
E130309D02Rik A T 5: 143,308,032 L230Q possibly damaging Het
Fbxo8 T A 8: 56,569,288 C112S probably damaging Het
Fndc3a T C 14: 72,563,540 D590G probably damaging Het
Gm19965 T A 1: 116,822,680 I697N possibly damaging Het
Gm35911 A G 5: 99,941,233 Y119C probably damaging Het
Greb1l G A 18: 10,469,494 D170N probably damaging Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Igfn1 A T 1: 135,964,661 probably null Het
Ighg2b T C 12: 113,306,892 E206G unknown Het
Lman2 T C 13: 55,348,431 N267S probably damaging Het
Lrfn5 A T 12: 61,843,562 I546F probably benign Het
Lrrc4c T C 2: 97,629,619 S197P probably damaging Het
Mbtd1 C T 11: 93,932,232 H493Y possibly damaging Het
Mdn1 C T 4: 32,730,054 R2799* probably null Het
Mup13 T A 4: 61,225,635 I148F probably benign Het
Olfr1023 A G 2: 85,886,815 N5S probably benign Het
Olfr170 A C 16: 19,605,930 V246G possibly damaging Het
Olfr968 A T 9: 39,772,226 D191E possibly damaging Het
Pdgfra A G 5: 75,173,474 K403E possibly damaging Het
Pigz A T 16: 31,944,937 Y271F probably damaging Het
Plekhg4 T C 8: 105,377,840 L517P probably damaging Het
Rnf20 T C 4: 49,642,132 L232P probably damaging Het
Rpa3 C A 6: 8,256,767 G71* probably null Het
Rsf1 GCG GCGACGGCGTCG 7: 97,579,907 probably benign Het
Rubcnl A G 14: 75,050,144 T623A probably benign Het
Sltm A G 9: 70,581,359 D597G probably damaging Het
Stpg2 T C 3: 139,701,671 V528A possibly damaging Het
Supt6 C T 11: 78,226,059 R589Q possibly damaging Het
Tas1r2 T A 4: 139,662,050 M419K possibly damaging Het
Txndc16 T C 14: 45,151,786 T486A probably benign Het
Vmn1r185 A G 7: 26,611,621 V153A probably benign Het
Vmn2r48 T C 7: 9,934,880 N548D probably damaging Het
Washc5 A G 15: 59,344,046 I378T possibly damaging Het
Wdr37 A G 13: 8,842,728 probably null Het
Xrn2 G A 2: 147,026,570 R181H probably damaging Het
Ylpm1 C G 12: 85,015,277 P651A unknown Het
Other mutations in Mdga2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Mdga2 APN 12 66723109 missense probably damaging 0.97
IGL01632:Mdga2 APN 12 66629898 splice site probably benign
IGL01843:Mdga2 APN 12 66723131 critical splice acceptor site probably null
IGL02230:Mdga2 APN 12 66655423 nonsense probably null
IGL02348:Mdga2 APN 12 66550575 missense probably damaging 1.00
IGL02473:Mdga2 APN 12 66550611 missense possibly damaging 0.73
IGL02795:Mdga2 APN 12 66689432 missense probably benign 0.00
IGL02901:Mdga2 APN 12 66797809 splice site probably benign
IGL03373:Mdga2 APN 12 66716722 missense probably damaging 0.99
PIT4362001:Mdga2 UTSW 12 66797768 missense possibly damaging 0.83
PIT4377001:Mdga2 UTSW 12 66716695 missense probably damaging 0.99
R0106:Mdga2 UTSW 12 66716706 missense probably damaging 1.00
R0106:Mdga2 UTSW 12 66716706 missense probably damaging 1.00
R0110:Mdga2 UTSW 12 66470926 missense possibly damaging 0.66
R0218:Mdga2 UTSW 12 66655120 missense probably damaging 1.00
R0450:Mdga2 UTSW 12 66470926 missense possibly damaging 0.66
R0801:Mdga2 UTSW 12 66486733 missense probably damaging 1.00
R0847:Mdga2 UTSW 12 66723080 missense probably damaging 1.00
R1056:Mdga2 UTSW 12 66723120 missense probably damaging 0.97
R1086:Mdga2 UTSW 12 66506102 splice site probably benign
R1335:Mdga2 UTSW 12 66716742 splice site probably null
R1382:Mdga2 UTSW 12 66470916 missense possibly damaging 0.68
R1490:Mdga2 UTSW 12 66797756 missense probably benign 0.01
R1521:Mdga2 UTSW 12 66568926 missense probably benign 0.00
R1556:Mdga2 UTSW 12 66550593 missense possibly damaging 0.92
R1676:Mdga2 UTSW 12 66568772 missense probably damaging 1.00
R1676:Mdga2 UTSW 12 66568773 nonsense probably null
R1698:Mdga2 UTSW 12 66689335 missense probably damaging 0.97
R1954:Mdga2 UTSW 12 66486708 splice site probably benign
R2069:Mdga2 UTSW 12 66568917 nonsense probably null
R2077:Mdga2 UTSW 12 66655362 missense probably damaging 1.00
R2118:Mdga2 UTSW 12 66868752 missense probably damaging 1.00
R2146:Mdga2 UTSW 12 66868741 missense probably damaging 1.00
R2158:Mdga2 UTSW 12 66689381 missense possibly damaging 0.64
R2189:Mdga2 UTSW 12 66473196 splice site probably null
R2293:Mdga2 UTSW 12 66568985 nonsense probably null
R2886:Mdga2 UTSW 12 66506270 splice site probably benign
R2960:Mdga2 UTSW 12 66629978 nonsense probably null
R3937:Mdga2 UTSW 12 67221206 unclassified probably benign
R4437:Mdga2 UTSW 12 66473198 splice site probably null
R4514:Mdga2 UTSW 12 66716722 missense probably damaging 0.99
R4693:Mdga2 UTSW 12 66797633 missense possibly damaging 0.81
R4719:Mdga2 UTSW 12 66471001 unclassified probably benign
R4744:Mdga2 UTSW 12 66797727 missense probably benign 0.01
R4756:Mdga2 UTSW 12 66797653 missense probably damaging 1.00
R4781:Mdga2 UTSW 12 66797622 splice site probably null
R5022:Mdga2 UTSW 12 66470760 missense possibly damaging 0.83
R5108:Mdga2 UTSW 12 66486741 missense probably benign 0.43
R5479:Mdga2 UTSW 12 66655176 missense probably damaging 1.00
R5710:Mdga2 UTSW 12 66506782 missense probably damaging 1.00
R5816:Mdga2 UTSW 12 66655182 missense probably damaging 1.00
R5822:Mdga2 UTSW 12 66655335 missense probably damaging 1.00
R5996:Mdga2 UTSW 12 66797763 missense probably benign 0.00
R6038:Mdga2 UTSW 12 66630053 missense probably damaging 1.00
R6038:Mdga2 UTSW 12 66630053 missense probably damaging 1.00
R6484:Mdga2 UTSW 12 66630069 missense possibly damaging 0.90
R6830:Mdga2 UTSW 12 66723001 missense probably damaging 1.00
R6912:Mdga2 UTSW 12 66506115 missense probably benign 0.01
R6971:Mdga2 UTSW 12 66550561 missense probably damaging 1.00
R7053:Mdga2 UTSW 12 66689384 missense probably benign 0.41
R7069:Mdga2 UTSW 12 66486752 missense probably benign 0.31
R7381:Mdga2 UTSW 12 66568896 missense probably benign 0.44
R7474:Mdga2 UTSW 12 66486761 nonsense probably null
R7559:Mdga2 UTSW 12 66473229 missense probably damaging 1.00
R7581:Mdga2 UTSW 12 66506255 missense probably damaging 0.99
R7596:Mdga2 UTSW 12 66506123 missense probably damaging 0.99
R7745:Mdga2 UTSW 12 66689350 missense probably damaging 0.99
R7745:Mdga2 UTSW 12 66689351 missense possibly damaging 0.63
R7852:Mdga2 UTSW 12 66470950 missense possibly damaging 0.66
R8144:Mdga2 UTSW 12 66655263 missense probably damaging 1.00
R8319:Mdga2 UTSW 12 67221029 missense unknown
Z1176:Mdga2 UTSW 12 66689443 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTCATGCTCTGTGTGAAAC -3'
(R):5'- ACACAGTTGAGAGATCAGGC -3'

Sequencing Primer
(F):5'- ATGCTCTGTGTGAAACTTTTATTAGG -3'
(R):5'- TGAGAGATCAGGCTGTTTTTATTTAC -3'
Posted On2018-04-02