Mutagenetix > Incidental Mutations

Incidental Mutation 'R6371:Cntln'

531218

Institutional Source

Beutler Lab

Gene Symbol

Cntln

Ensembl Gene

ENSMUSG00000038070

Gene Name

centlein, centrosomal protein

Synonyms

B430108F07Rik, D530005L17Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.245) question?

Stock #

R6371 (G1)

Quality Score

46.0072

Status

Validated

Chromosome

Chromosomal Location

84884309-85131921 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 84884579 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 39 (S39P)

Ref Sequence

ENSEMBL: ENSMUSP00000130491 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047023] [ENSMUST00000102819] [ENSMUST00000169371]

Predicted Effect

probably damaging
Transcript: ENSMUST00000047023
AA Change: S39P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000044138
Gene: ENSMUSG00000038070
AA Change: S39P

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	58	86	N/A	INTRINSIC
coiled coil region	96	126	N/A	INTRINSIC
internal_repeat_1	198	219	1.25e-5	PROSPERO
low complexity region	242	251	N/A	INTRINSIC
internal_repeat_1	321	342	1.25e-5	PROSPERO
low complexity region	346	358	N/A	INTRINSIC
coiled coil region	404	433	N/A	INTRINSIC
low complexity region	434	446	N/A	INTRINSIC
coiled coil region	458	481	N/A	INTRINSIC
coiled coil region	516	584	N/A	INTRINSIC
coiled coil region	606	648	N/A	INTRINSIC
coiled coil region	674	780	N/A	INTRINSIC
low complexity region	815	829	N/A	INTRINSIC
coiled coil region	973	1114	N/A	INTRINSIC
low complexity region	1206	1217	N/A	INTRINSIC
Blast:HisKA	1270	1326	1e-24	BLAST
low complexity region	1327	1348	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000102819
AA Change: S39P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000099883
Gene: ENSMUSG00000038070
AA Change: S39P

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	58	86	N/A	INTRINSIC
coiled coil region	96	126	N/A	INTRINSIC
coiled coil region	166	277	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000169371
AA Change: S39P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000130491
Gene: ENSMUSG00000038070
AA Change: S39P

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	58	86	N/A	INTRINSIC
coiled coil region	96	126	N/A	INTRINSIC
internal_repeat_1	198	219	1.24e-5	PROSPERO
low complexity region	242	251	N/A	INTRINSIC
internal_repeat_1	321	342	1.24e-5	PROSPERO
low complexity region	346	358	N/A	INTRINSIC
coiled coil region	404	433	N/A	INTRINSIC
low complexity region	434	446	N/A	INTRINSIC
coiled coil region	458	481	N/A	INTRINSIC
coiled coil region	516	584	N/A	INTRINSIC
coiled coil region	606	648	N/A	INTRINSIC
coiled coil region	674	780	N/A	INTRINSIC
low complexity region	815	829	N/A	INTRINSIC
coiled coil region	972	1113	N/A	INTRINSIC
low complexity region	1205	1216	N/A	INTRINSIC
Blast:HisKA	1269	1325	1e-24	BLAST
low complexity region	1326	1347	N/A	INTRINSIC

Meta Mutation Damage Score

0.0714

Coding Region Coverage

1x: 100.0%
3x: 99.7%
10x: 98.2%
20x: 94.1%

Validation Efficiency

98% (50/51)

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam6b	C	T	12: 113,490,274	S237L	probably damaging	Het
Ank3	T	G	10: 69,808,879	L58V	probably damaging	Het
Arsb	A	T	13: 93,790,066	I115F	possibly damaging	Het
Atad2b	T	C	12: 4,973,970	Y32H	probably damaging	Het
Brd1	A	C	15: 88,713,998	M515R	probably benign	Het
Cbx7	A	G	15: 79,918,822	S30P	possibly damaging	Het
Cdk12	A	G	11: 98,245,288	T1123A	unknown	Het
Cep170b	A	G	12: 112,740,945	D375G	probably damaging	Het
Clcn3	T	C	8: 60,937,335	K164E	probably benign	Het
Clip4	A	C	17: 71,856,464	K677T	probably damaging	Het
Clrn2	T	C	5: 45,460,198	I137T	possibly damaging	Het
Crocc2	T	A	1: 93,215,631	N1318K	probably benign	Het
Emc1	C	T	4: 139,371,665	Q820*	probably null	Het
Fam71e2	A	G	7: 4,759,359	V257A	probably benign	Het
Fbxl2	G	A	9: 113,989,383	T170I	probably damaging	Het
Fyb2	A	G	4: 104,995,778	T552A	probably damaging	Het
Gm2381	G	A	7: 42,820,586	A38V	probably benign	Het
Gpt2	G	A	8: 85,518,052	E325K	probably benign	Het
Helz2	C	T	2: 181,233,467	E1745K	probably damaging	Het
Hspg2	T	C	4: 137,541,695	Y2213H	probably damaging	Het
Ifnar2	T	C	16: 91,388,098	Y24H	possibly damaging	Het
Inpp5d	T	A	1: 87,699,675	L566Q	probably damaging	Het
Itgb2	C	A	10: 77,548,597	P184H	probably damaging	Het
Kcnb2	T	A	1: 15,711,212	D769E	probably benign	Het
Lrp1b	A	G	2: 40,851,654	M3087T	possibly damaging	Het
Ltbp3	A	G	19: 5,745,772		probably null	Het
Ms4a6b	A	G	19: 11,520,364	E9G	probably damaging	Het
Nat3	G	A	8: 67,524,179		probably null	Het
Ndufaf1	A	T	2: 119,660,053	D175E	probably damaging	Het
Nop58	T	G	1: 59,711,312		probably benign	Het
Olfr122	A	G	17: 37,772,435	T261A	probably benign	Het
Olfr285	A	G	15: 98,313,338	Y71H	possibly damaging	Het
P3h4	C	T	11: 100,411,749	E354K	probably benign	Het
Plekhm2	T	G	4: 141,629,532	T787P	possibly damaging	Het
Ppia	C	T	11: 6,418,230	T37I	probably benign	Het
Reln	T	A	5: 21,995,513	M1330L	probably benign	Het
Ric1	A	G	19: 29,562,026	E53G	probably benign	Het
Sgip1	T	A	4: 102,966,285	V721E	probably damaging	Het
Slc33a1	A	T	3: 63,943,288	D538E	probably benign	Het
Son	T	C	16: 91,674,741			Het
Srebf1	A	T	11: 60,203,515	S591R	probably damaging	Het
St3gal1	A	G	15: 67,111,346	V187A	possibly damaging	Het
Taok2	G	A	7: 126,870,147	R1170W	probably damaging	Het
Tsc2	A	T	17: 24,626,714	V210E	probably benign	Het
Ttc6	T	A	12: 57,728,463	N1648K	possibly damaging	Het
Vgll3	C	T	16: 65,839,245	P94L	probably damaging	Het
Vmn2r54	A	T	7: 12,615,435	V740E	probably damaging	Het
Yeats2	A	G	16: 20,221,710	E1127G	possibly damaging	Het
Zfp709	T	A	8: 71,889,485	Y252N	probably damaging	Het

Other mutations in Cntln

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00639:Cntln	APN	4	85006434	missense	probably benign	0.25
IGL00743:Cntln	APN	4	84979415	missense	probably benign	0.06
IGL01014:Cntln	APN	4	85049908	missense	probably benign	0.25
IGL02217:Cntln	APN	4	85100258	missense	probably damaging	1.00
IGL02323:Cntln	APN	4	85049789	missense	probably benign	0.00
IGL02353:Cntln	APN	4	85049850	missense	probably damaging	0.98
IGL02360:Cntln	APN	4	85049850	missense	probably damaging	0.98
IGL02616:Cntln	APN	4	85115452	critical splice donor site	probably null
PIT4696001:Cntln	UTSW	4	84974000	missense	probably damaging	0.99
R0110:Cntln	UTSW	4	85096757	missense	probably damaging	1.00
R0324:Cntln	UTSW	4	85092695	missense	probably damaging	0.98
R0349:Cntln	UTSW	4	84996485	missense	probably damaging	1.00
R0519:Cntln	UTSW	4	85005053	splice site	probably benign
R0529:Cntln	UTSW	4	85067825	missense	probably damaging	1.00
R0582:Cntln	UTSW	4	84884741	missense	probably damaging	1.00
R1077:Cntln	UTSW	4	84996479	missense	probably damaging	1.00
R1345:Cntln	UTSW	4	84973991	missense	probably damaging	1.00
R1457:Cntln	UTSW	4	85096839	missense	probably benign	0.33
R1571:Cntln	UTSW	4	84947586	nonsense	probably null
R1622:Cntln	UTSW	4	85063181	missense	probably damaging	1.00
R1681:Cntln	UTSW	4	84947635	missense	probably damaging	1.00
R1777:Cntln	UTSW	4	85130679	missense	probably benign	0.23
R1808:Cntln	UTSW	4	85096763	missense	probably damaging	1.00
R1882:Cntln	UTSW	4	85100835	missense	probably damaging	1.00
R2056:Cntln	UTSW	4	85049674	missense	probably benign
R2965:Cntln	UTSW	4	84974027	critical splice donor site	probably null
R2968:Cntln	UTSW	4	84957267	missense	probably benign	0.27
R3104:Cntln	UTSW	4	84957169	missense	possibly damaging	0.95
R3106:Cntln	UTSW	4	84957169	missense	possibly damaging	0.95
R3121:Cntln	UTSW	4	85005052	splice site	probably benign
R3617:Cntln	UTSW	4	85004977	nonsense	probably null
R4009:Cntln	UTSW	4	85063215	missense	probably benign	0.45
R4036:Cntln	UTSW	4	85006488	missense	probably damaging	1.00
R4548:Cntln	UTSW	4	85096842	missense	probably benign	0.27
R4592:Cntln	UTSW	4	84971182	missense	probably benign	0.00
R4666:Cntln	UTSW	4	84971216	missense	probably benign	0.13
R4826:Cntln	UTSW	4	85005044	missense	probably benign	0.03
R4836:Cntln	UTSW	4	85049720	nonsense	probably null
R4856:Cntln	UTSW	4	84971229	missense	probably benign	0.35
R4886:Cntln	UTSW	4	84971229	missense	probably benign	0.35
R4995:Cntln	UTSW	4	85049883	missense	probably benign	0.00
R5090:Cntln	UTSW	4	84947593	missense	probably damaging	0.98
R5202:Cntln	UTSW	4	84971229	missense	probably benign	0.35
R5905:Cntln	UTSW	4	84971173	missense	probably benign	0.03
R5953:Cntln	UTSW	4	85049919	missense	possibly damaging	0.92
R6028:Cntln	UTSW	4	84971173	missense	probably benign	0.03
R6298:Cntln	UTSW	4	85096761	missense	probably damaging	1.00
R6351:Cntln	UTSW	4	85115354	missense	probably damaging	0.99
R6481:Cntln	UTSW	4	85067510	missense	probably benign	0.00
R6864:Cntln	UTSW	4	85096792	missense	probably damaging	0.99
R6874:Cntln	UTSW	4	85067759	missense	probably damaging	1.00
R6919:Cntln	UTSW	4	85115368	missense	probably benign	0.04
R7071:Cntln	UTSW	4	85100385	missense	probably damaging	1.00
R7113:Cntln	UTSW	4	85049827	missense	probably damaging	0.98
R7152:Cntln	UTSW	4	84884700	missense	possibly damaging	0.87
R7253:Cntln	UTSW	4	85118473	missense	probably damaging	1.00
R7289:Cntln	UTSW	4	85046303	missense	possibly damaging	0.80
R7440:Cntln	UTSW	4	85063216	missense	possibly damaging	0.95
R7670:Cntln	UTSW	4	84979340	missense	possibly damaging	0.66
R7707:Cntln	UTSW	4	84884616	missense	probably damaging	1.00
R7895:Cntln	UTSW	4	85063324	missense	possibly damaging	0.91
R8176:Cntln	UTSW	4	84888689	missense	probably damaging	0.99
R8247:Cntln	UTSW	4	85100780	missense	probably benign	0.39
R8264:Cntln	UTSW	4	85098411	missense	probably damaging	1.00
R8293:Cntln	UTSW	4	85033838	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGTCAGGCACTTCGGACTC -3'
(R):5'- CCAGTCCTGATACCTGACACAG -3'

Sequencing Primer
(F):5'- CAATGAACTTGCTGGTCGAG -3'
(R):5'- AGGGCCAGCTCCTCCTTTAG -3'

Posted On

2018-08-06