Incidental Mutation 'R6255:Cherp'
ID 529326
Institutional Source Beutler Lab
Gene Symbol Cherp
Ensembl Gene ENSMUSG00000052488
Gene Name calcium homeostasis endoplasmic reticulum protein
Synonyms DAN16, SCAF6, D8Wsu96e, 5730408I11Rik
MMRRC Submission 044372-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock # R6255 (G1)
Quality Score 56.0072
Status Validated
Chromosome 8
Chromosomal Location 72460489-72475226 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 72470881 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Aspartic acid at position 125 (A125D)
Ref Sequence ENSEMBL: ENSMUSP00000148273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079510] [ENSMUST00000212991]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000079510
AA Change: A125D

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000078469
Gene: ENSMUSG00000052488
AA Change: A125D

SWAP 13 65 9.76e-24 SMART
low complexity region 78 100 N/A INTRINSIC
low complexity region 107 124 N/A INTRINSIC
RPR 156 286 5.32e-2 SMART
coiled coil region 310 334 N/A INTRINSIC
low complexity region 362 385 N/A INTRINSIC
low complexity region 409 419 N/A INTRINSIC
low complexity region 439 463 N/A INTRINSIC
low complexity region 488 500 N/A INTRINSIC
low complexity region 526 560 N/A INTRINSIC
low complexity region 565 580 N/A INTRINSIC
low complexity region 591 606 N/A INTRINSIC
low complexity region 725 736 N/A INTRINSIC
low complexity region 743 829 N/A INTRINSIC
G_patch 850 900 9.8e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183439
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212070
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212586
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212870
Predicted Effect probably damaging
Transcript: ENSMUST00000212991
AA Change: A125D

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,466,123 V7E possibly damaging Het
Aars2 G A 17: 45,514,609 G333S probably damaging Het
Aen T A 7: 78,905,844 I85N probably damaging Het
Ahnak C A 19: 9,008,025 H2224Q possibly damaging Het
Aldh18a1 C T 19: 40,580,043 R41H possibly damaging Het
Bpifb9b T A 2: 154,309,364 W2R probably damaging Het
Caprin2 A G 6: 148,877,892 I139T probably benign Het
Cdhr3 T A 12: 33,053,475 N381I probably damaging Het
Cecr2 A G 6: 120,758,050 Y721C probably damaging Het
Cped1 G A 6: 22,138,715 probably null Het
Ctdp1 T A 18: 80,459,297 probably null Het
Cyp2c55 T C 19: 39,018,667 I169T probably benign Het
Cyp4a31 T C 4: 115,574,920 L418P possibly damaging Het
Efcab7 T C 4: 99,829,390 probably benign Het
Efcab8 T C 2: 153,810,268 W466R possibly damaging Het
Ehd3 C A 17: 73,805,413 N57K probably benign Het
Ern2 C A 7: 122,173,272 K654N probably damaging Het
Fbxo18 A T 2: 11,748,446 F879L probably benign Het
Gde1 T C 7: 118,691,781 D92G probably null Het
Gm4788 A T 1: 139,753,011 C256* probably null Het
Heatr5b A G 17: 78,803,434 V995A probably damaging Het
Ifrd2 A G 9: 107,592,091 E346G probably damaging Het
Ism1 AACGGACCCGTTCTTGTGGCTATGCA AA 2: 139,746,042 probably benign Het
Itgb4 T C 11: 115,998,137 V1102A possibly damaging Het
Itgb6 A T 2: 60,605,276 I710N probably damaging Het
Kif1a T C 1: 93,019,983 K1578E probably damaging Het
Kif9 T C 9: 110,517,834 probably null Het
Kitl T C 10: 100,089,233 *57Q probably null Het
Lrat C A 3: 82,903,505 V70F probably damaging Het
Lrrc9 T A 12: 72,487,023 M1022K probably benign Het
Muc16 T C 9: 18,655,599 T1875A unknown Het
Mup4 T A 4: 59,957,890 N171I probably damaging Het
Npas4 G A 19: 4,986,375 T587I probably damaging Het
Oas3 A G 5: 120,771,230 V217A probably benign Het
Olfr786 A G 10: 129,437,688 N292S possibly damaging Het
Osbp C A 19: 11,977,953 A323D possibly damaging Het
Panx2 G A 15: 89,067,618 R96H probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Piezo2 T C 18: 63,121,270 R385G possibly damaging Het
Pkn2 T C 3: 142,811,599 T476A probably damaging Het
Plekha4 T C 7: 45,553,802 probably benign Het
Ppfibp2 T C 7: 107,681,762 S94P probably damaging Het
Pramel7 T A 2: 87,489,663 I429L probably benign Het
Rif1 A G 2: 52,085,053 K325E probably damaging Het
Ror2 T C 13: 53,110,542 Y826C probably damaging Het
Rsph10b G A 5: 143,959,746 G19R probably damaging Het
Slc20a1 A G 2: 129,208,004 N361D probably damaging Het
Slc26a9 A G 1: 131,763,909 D630G probably benign Het
Smtnl2 G A 11: 72,401,399 A274V probably damaging Het
Trank1 T C 9: 111,352,246 probably null Het
Tspan10 T A 11: 120,444,542 C159* probably null Het
Uba6 G A 5: 86,164,765 T23I probably benign Het
Vmn2r74 T C 7: 85,952,451 T660A possibly damaging Het
Vwa5b1 T C 4: 138,578,672 N905S probably benign Het
Zfp831 T C 2: 174,646,421 L963P possibly damaging Het
Zfp990 T A 4: 145,537,789 N452K probably benign Het
Other mutations in Cherp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Cherp APN 8 72468246 missense probably damaging 0.97
IGL00955:Cherp APN 8 72470194 missense probably damaging 0.99
R0452:Cherp UTSW 8 72461522 unclassified probably benign
R0479:Cherp UTSW 8 72463147 missense possibly damaging 0.66
R0594:Cherp UTSW 8 72462402 critical splice donor site probably null
R1734:Cherp UTSW 8 72470088 critical splice donor site probably null
R1781:Cherp UTSW 8 72467771 missense probably damaging 1.00
R1793:Cherp UTSW 8 72463150 missense probably benign 0.12
R2012:Cherp UTSW 8 72474769 missense probably damaging 0.98
R2845:Cherp UTSW 8 72466403 missense probably damaging 0.99
R3612:Cherp UTSW 8 72461996 unclassified probably benign
R3693:Cherp UTSW 8 72467911 small deletion probably benign
R3899:Cherp UTSW 8 72469936 missense possibly damaging 0.63
R3900:Cherp UTSW 8 72469936 missense possibly damaging 0.63
R3970:Cherp UTSW 8 72469951 missense possibly damaging 0.60
R4915:Cherp UTSW 8 72468397 missense probably damaging 1.00
R5512:Cherp UTSW 8 72463266 missense possibly damaging 0.66
R5556:Cherp UTSW 8 72467980 missense probably damaging 0.99
R5739:Cherp UTSW 8 72467815 small deletion probably benign
R5768:Cherp UTSW 8 72463113 missense probably damaging 0.98
R5824:Cherp UTSW 8 72462258 unclassified probably benign
R5963:Cherp UTSW 8 72461535 unclassified probably benign
R7145:Cherp UTSW 8 72468386 missense
R7538:Cherp UTSW 8 72462419 missense
R7578:Cherp UTSW 8 72464258 missense
R8329:Cherp UTSW 8 72462008 missense
RF001:Cherp UTSW 8 72462049 frame shift probably null
RF007:Cherp UTSW 8 72462059 small deletion probably benign
RF036:Cherp UTSW 8 72462044 frame shift probably null
RF036:Cherp UTSW 8 72462047 frame shift probably null
RF059:Cherp UTSW 8 72462055 frame shift probably null
T0722:Cherp UTSW 8 72462034 small deletion probably benign
T0975:Cherp UTSW 8 72462034 small deletion probably benign
Z1176:Cherp UTSW 8 72470953 missense
Z1177:Cherp UTSW 8 72462916 missense
Z1177:Cherp UTSW 8 72475135 start gained probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2018-07-31