Incidental Mutation 'R6255:Zfp831'
ID506041
Institutional Source Beutler Lab
Gene Symbol Zfp831
Ensembl Gene ENSMUSG00000050600
Gene Namezinc finger protein 831
SynonymsENSMUSG00000050600, OTTMUSG00000017459
MMRRC Submission 044372-MU
Accession Numbers

Genbank: NM_001099328; MGI: 3641861

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6255 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location174643534-174710832 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 174646421 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 963 (L963P)
Ref Sequence ENSEMBL: ENSMUSP00000060255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059452]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059452
AA Change: L963P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000060255
Gene: ENSMUSG00000050600
AA Change: L963P

DomainStartEndE-ValueType
low complexity region 120 135 N/A INTRINSIC
ZnF_C2H2 143 165 5.06e-2 SMART
ZnF_C2H2 171 195 7.78e-3 SMART
low complexity region 201 216 N/A INTRINSIC
low complexity region 237 248 N/A INTRINSIC
low complexity region 345 371 N/A INTRINSIC
low complexity region 383 392 N/A INTRINSIC
low complexity region 447 459 N/A INTRINSIC
low complexity region 645 657 N/A INTRINSIC
low complexity region 717 736 N/A INTRINSIC
low complexity region 856 870 N/A INTRINSIC
low complexity region 1520 1529 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,466,123 V7E possibly damaging Het
Aars2 G A 17: 45,514,609 G333S probably damaging Het
Aen T A 7: 78,905,844 I85N probably damaging Het
Ahnak C A 19: 9,008,025 H2224Q possibly damaging Het
Aldh18a1 C T 19: 40,580,043 R41H possibly damaging Het
Bpifb9b T A 2: 154,309,364 W2R probably damaging Het
Caprin2 A G 6: 148,877,892 I139T probably benign Het
Cdhr3 T A 12: 33,053,475 N381I probably damaging Het
Cecr2 A G 6: 120,758,050 Y721C probably damaging Het
Cherp G T 8: 72,470,881 A125D probably damaging Het
Cped1 G A 6: 22,138,715 probably null Het
Ctdp1 T A 18: 80,459,297 probably null Het
Cyp2c55 T C 19: 39,018,667 I169T probably benign Het
Cyp4a31 T C 4: 115,574,920 L418P possibly damaging Het
Efcab7 T C 4: 99,829,390 probably benign Het
Efcab8 T C 2: 153,810,268 W466R possibly damaging Het
Ehd3 C A 17: 73,805,413 N57K probably benign Het
Ern2 C A 7: 122,173,272 K654N probably damaging Het
Fbxo18 A T 2: 11,748,446 F879L probably benign Het
Gde1 T C 7: 118,691,781 D92G probably null Het
Gm4788 A T 1: 139,753,011 C256* probably null Het
Heatr5b A G 17: 78,803,434 V995A probably damaging Het
Ifrd2 A G 9: 107,592,091 E346G probably damaging Het
Ism1 AACGGACCCGTTCTTGTGGCTATGCA AA 2: 139,746,042 probably benign Het
Itgb4 T C 11: 115,998,137 V1102A possibly damaging Het
Itgb6 A T 2: 60,605,276 I710N probably damaging Het
Kif1a T C 1: 93,019,983 K1578E probably damaging Het
Kif9 T C 9: 110,517,834 probably null Het
Kitl T C 10: 100,089,233 *57Q probably null Het
Lrat C A 3: 82,903,505 V70F probably damaging Het
Lrrc9 T A 12: 72,487,023 M1022K probably benign Het
Muc16 T C 9: 18,655,599 T1875A unknown Het
Mup4 T A 4: 59,957,890 N171I probably damaging Het
Npas4 G A 19: 4,986,375 T587I probably damaging Het
Oas3 A G 5: 120,771,230 V217A probably benign Het
Olfr786 A G 10: 129,437,688 N292S possibly damaging Het
Osbp C A 19: 11,977,953 A323D possibly damaging Het
Panx2 G A 15: 89,067,618 R96H probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Piezo2 T C 18: 63,121,270 R385G possibly damaging Het
Pkn2 T C 3: 142,811,599 T476A probably damaging Het
Plekha4 T C 7: 45,553,802 probably benign Het
Ppfibp2 T C 7: 107,681,762 S94P probably damaging Het
Pramel7 T A 2: 87,489,663 I429L probably benign Het
Rif1 A G 2: 52,085,053 K325E probably damaging Het
Ror2 T C 13: 53,110,542 Y826C probably damaging Het
Rsph10b G A 5: 143,959,746 G19R probably damaging Het
Slc20a1 A G 2: 129,208,004 N361D probably damaging Het
Slc26a9 A G 1: 131,763,909 D630G probably benign Het
Smtnl2 G A 11: 72,401,399 A274V probably damaging Het
Trank1 T C 9: 111,352,246 probably null Het
Tspan10 T A 11: 120,444,542 C159* probably null Het
Uba6 G A 5: 86,164,765 T23I probably benign Het
Vmn2r74 T C 7: 85,952,451 T660A possibly damaging Het
Vwa5b1 T C 4: 138,578,672 N905S probably benign Het
Zfp990 T A 4: 145,537,789 N452K probably benign Het
Other mutations in Zfp831
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Zfp831 APN 2 174646285 missense possibly damaging 0.86
IGL00091:Zfp831 APN 2 174645658 missense possibly damaging 0.73
IGL00764:Zfp831 APN 2 174645908 missense possibly damaging 0.72
IGL01538:Zfp831 APN 2 174644606 missense possibly damaging 0.72
IGL01700:Zfp831 APN 2 174644918 missense possibly damaging 0.86
IGL01718:Zfp831 APN 2 174643838 missense possibly damaging 0.86
IGL02221:Zfp831 APN 2 174643726 missense probably benign 0.33
IGL02250:Zfp831 APN 2 174648201 missense possibly damaging 0.53
IGL03209:Zfp831 APN 2 174645266 missense probably benign 0.40
D4043:Zfp831 UTSW 2 174645266 missense probably benign 0.40
FR4304:Zfp831 UTSW 2 174645481 small insertion probably benign
FR4340:Zfp831 UTSW 2 174645480 small insertion probably benign
FR4449:Zfp831 UTSW 2 174645471 small insertion probably benign
FR4449:Zfp831 UTSW 2 174645482 small insertion probably benign
FR4589:Zfp831 UTSW 2 174645468 small insertion probably benign
FR4737:Zfp831 UTSW 2 174645471 small insertion probably benign
FR4737:Zfp831 UTSW 2 174645476 small insertion probably benign
FR4737:Zfp831 UTSW 2 174645483 small insertion probably benign
IGL02802:Zfp831 UTSW 2 174645152 missense possibly damaging 0.73
P0028:Zfp831 UTSW 2 174645346 missense possibly damaging 0.53
PIT4531001:Zfp831 UTSW 2 174646723 missense possibly damaging 0.90
R0631:Zfp831 UTSW 2 174645290 missense possibly damaging 0.53
R0644:Zfp831 UTSW 2 174645863 missense probably benign 0.33
R0782:Zfp831 UTSW 2 174646630 missense probably benign 0.06
R1156:Zfp831 UTSW 2 174646917 missense possibly damaging 0.53
R1280:Zfp831 UTSW 2 174704059 missense probably benign 0.00
R1709:Zfp831 UTSW 2 174645890 missense probably benign 0.33
R1883:Zfp831 UTSW 2 174704077 missense possibly damaging 0.53
R1884:Zfp831 UTSW 2 174704077 missense possibly damaging 0.53
R2127:Zfp831 UTSW 2 174648124 missense probably benign 0.33
R2137:Zfp831 UTSW 2 174705746 missense possibly damaging 0.53
R2268:Zfp831 UTSW 2 174644241 missense probably benign 0.01
R2330:Zfp831 UTSW 2 174648089 nonsense probably null
R3547:Zfp831 UTSW 2 174657683 missense probably benign
R3821:Zfp831 UTSW 2 174644023 missense possibly damaging 0.73
R4163:Zfp831 UTSW 2 174644029 missense possibly damaging 0.53
R4232:Zfp831 UTSW 2 174705654 missense possibly damaging 0.96
R4778:Zfp831 UTSW 2 174646807 missense possibly damaging 0.53
R4820:Zfp831 UTSW 2 174705304 missense possibly damaging 0.73
R4912:Zfp831 UTSW 2 174644624 missense probably damaging 1.00
R5119:Zfp831 UTSW 2 174705310 missense probably benign 0.18
R5152:Zfp831 UTSW 2 174644564 missense probably benign 0.33
R5723:Zfp831 UTSW 2 174645407 missense probably benign 0.23
R5741:Zfp831 UTSW 2 174645152 missense possibly damaging 0.73
R5888:Zfp831 UTSW 2 174643627 missense probably benign 0.18
R5975:Zfp831 UTSW 2 174644092 missense possibly damaging 0.93
R6092:Zfp831 UTSW 2 174705506 missense probably damaging 0.98
R6158:Zfp831 UTSW 2 174643858 missense possibly damaging 0.53
R6212:Zfp831 UTSW 2 174645868 missense possibly damaging 0.53
R6233:Zfp831 UTSW 2 174646697 missense possibly damaging 0.85
R6248:Zfp831 UTSW 2 174644515 missense possibly damaging 0.53
R6460:Zfp831 UTSW 2 174646567 missense possibly damaging 0.46
R6477:Zfp831 UTSW 2 174704167 missense probably benign
R6864:Zfp831 UTSW 2 174646740 missense possibly damaging 0.72
R7396:Zfp831 UTSW 2 174645209 missense possibly damaging 0.73
R7447:Zfp831 UTSW 2 174646103 missense possibly damaging 0.88
R7499:Zfp831 UTSW 2 174644023 missense possibly damaging 0.73
R7662:Zfp831 UTSW 2 174646141 missense possibly damaging 0.85
R7857:Zfp831 UTSW 2 174705242 missense probably benign 0.33
R7889:Zfp831 UTSW 2 174645304 missense possibly damaging 0.53
R7896:Zfp831 UTSW 2 174647128 missense possibly damaging 0.53
R7940:Zfp831 UTSW 2 174705242 missense probably benign 0.33
R7972:Zfp831 UTSW 2 174645304 missense possibly damaging 0.53
R7979:Zfp831 UTSW 2 174647128 missense possibly damaging 0.53
R8074:Zfp831 UTSW 2 174644735 missense possibly damaging 0.72
X0021:Zfp831 UTSW 2 174705869 missense possibly damaging 0.85
Z1177:Zfp831 UTSW 2 174644188 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGTCCCTAATGCTCGGTCAG -3'
(R):5'- TACTCACTACATCCTGGGCCAC -3'

Sequencing Primer
(F):5'- CTAATGCTCGGTCAGGTGGC -3'
(R):5'- ACCCGAATGTCACAGGTGTG -3'
Posted On2018-02-28