Incidental Mutation 'R6749:Slc6a20a'
ID532894
Institutional Source Beutler Lab
Gene Symbol Slc6a20a
Ensembl Gene ENSMUSG00000036814
Gene Namesolute carrier family 6 (neurotransmitter transporter), member 20A
SynonymsXtrp3s1, A730081N20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6749 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location123634770-123678885 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123637070 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 569 (C569R)
Ref Sequence ENSEMBL: ENSMUSP00000047690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026273] [ENSMUST00000040960] [ENSMUST00000166800] [ENSMUST00000171647]
Predicted Effect probably benign
Transcript: ENSMUST00000026273
SMART Domains Protein: ENSMUSP00000026273
Gene: ENSMUSG00000025243

DomainStartEndE-ValueType
low complexity region 19 33 N/A INTRINSIC
Pfam:SNF 48 624 5.4e-173 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000040960
AA Change: C569R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047690
Gene: ENSMUSG00000036814
AA Change: C569R

DomainStartEndE-ValueType
Pfam:SNF 5 581 1.7e-177 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163397
SMART Domains Protein: ENSMUSP00000127422
Gene: ENSMUSG00000025243

DomainStartEndE-ValueType
Pfam:SNF 23 59 1.8e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166800
Predicted Effect probably benign
Transcript: ENSMUST00000168824
SMART Domains Protein: ENSMUSP00000129307
Gene: ENSMUSG00000025243

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
Pfam:SNF 38 74 3.3e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171647
AA Change: C532R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129107
Gene: ENSMUSG00000036814
AA Change: C532R

DomainStartEndE-ValueType
Pfam:SNF 5 196 3.3e-72 PFAM
Pfam:SNF 194 544 8.4e-85 PFAM
Meta Mutation Damage Score 0.3927 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transport of small hydrophilic substances across cell membranes is mediated by substrate-specific transporter proteins which have been classified into several families of related genes. The protein encoded by this gene is a member of the subgroup of transporter with unidentified substrates within the Na+ and Cl- coupled transporter family. This gene is expressed in kidney, and its alternative splicing generates 2 transcript variants. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,010,774 V875A possibly damaging Het
Arhgef15 A T 11: 68,954,557 F156L probably damaging Het
Bdh2 T A 3: 135,300,691 S184T probably damaging Het
Bmp5 A T 9: 75,776,093 M1L probably benign Het
Cacfd1 T C 2: 27,018,455 Y134H probably damaging Het
Camk1 G A 6: 113,334,525 P340L probably benign Het
Ccdc105 A C 10: 78,752,838 M46R possibly damaging Het
Cdc14a T C 3: 116,297,158 H424R possibly damaging Het
Cntfr T A 4: 41,663,232 T192S possibly damaging Het
Erbin G T 13: 103,834,377 S910R probably damaging Het
Esrp1 A T 4: 11,357,519 V366E probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fsip2 T A 2: 82,978,394 S1686T possibly damaging Het
Gata5 A G 2: 180,334,350 L7S probably damaging Het
Hgf T A 5: 16,613,642 probably null Het
Ift140 A G 17: 25,098,916 E1458G probably damaging Het
Ift57 G A 16: 49,760,984 G209R probably benign Het
Il12rb2 G T 6: 67,361,966 probably benign Het
Krt78 G A 15: 101,950,923 R280C probably damaging Het
Lipc A G 9: 70,823,386 I88T probably damaging Het
Lrmda G T 14: 22,027,276 R27L probably benign Het
Lrrc37a T G 11: 103,502,097 E834A probably benign Het
Mmachc C A 4: 116,704,541 R132L probably damaging Het
Myo10 T C 15: 25,714,110 Y88H probably damaging Het
Myo5b G A 18: 74,701,503 R878Q possibly damaging Het
Olfr1392 A G 11: 49,294,050 H243R probably damaging Het
Padi3 T C 4: 140,795,853 T289A possibly damaging Het
Pcdhgb4 G T 18: 37,721,229 A226S possibly damaging Het
Pde4c T C 8: 70,746,010 V167A probably damaging Het
Pigr A G 1: 130,846,548 T422A probably benign Het
Pmp2 T C 3: 10,182,482 Y49C probably benign Het
Prpf39 A G 12: 65,056,274 I441V possibly damaging Het
Ptprs A G 17: 56,437,884 V284A probably damaging Het
Rsad1 T C 11: 94,543,340 E354G probably damaging Het
Sema4b T A 7: 80,220,201 D412E possibly damaging Het
Siglecg A G 7: 43,408,979 I97V probably benign Het
Slc4a3 C T 1: 75,554,538 R792* probably null Het
Spata19 T C 9: 27,397,980 V59A probably benign Het
Sult2a3 T A 7: 14,082,704 Y183F probably benign Het
Tedc1 C T 12: 113,158,082 T194M probably damaging Het
Tmem63c T A 12: 87,075,665 N412K probably damaging Het
Trav5-1 T C 14: 52,622,945 I69T possibly damaging Het
Trim68 T C 7: 102,678,783 D321G probably damaging Het
Ttn T C 2: 76,865,256 probably benign Het
Vars2 A G 17: 35,666,713 V109A probably damaging Het
Vmn2r96 C T 17: 18,598,090 P643L probably damaging Het
Zfpm2 G T 15: 40,954,708 V146F possibly damaging Het
Znfx1 T C 2: 167,056,599 K135R probably benign Het
Other mutations in Slc6a20a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02097:Slc6a20a APN 9 123660619 missense possibly damaging 0.95
eyeful UTSW 9 123637070 missense probably damaging 1.00
R0115:Slc6a20a UTSW 9 123678758 missense possibly damaging 0.84
R0255:Slc6a20a UTSW 9 123664621 missense probably damaging 1.00
R0512:Slc6a20a UTSW 9 123660406 missense probably damaging 1.00
R1744:Slc6a20a UTSW 9 123662993 missense probably benign 0.01
R1751:Slc6a20a UTSW 9 123637100 missense probably damaging 1.00
R1767:Slc6a20a UTSW 9 123637100 missense probably damaging 1.00
R1908:Slc6a20a UTSW 9 123656308 missense probably damaging 1.00
R1983:Slc6a20a UTSW 9 123640587 missense probably damaging 1.00
R2391:Slc6a20a UTSW 9 123664621 missense probably damaging 1.00
R3107:Slc6a20a UTSW 9 123641708 critical splice donor site probably null
R3547:Slc6a20a UTSW 9 123660502 missense probably damaging 1.00
R3760:Slc6a20a UTSW 9 123662989 missense probably damaging 0.99
R4126:Slc6a20a UTSW 9 123660533 missense probably damaging 1.00
R5584:Slc6a20a UTSW 9 123640688 missense probably damaging 1.00
R5881:Slc6a20a UTSW 9 123641708 critical splice donor site probably null
R7447:Slc6a20a UTSW 9 123656224 missense possibly damaging 0.47
R7687:Slc6a20a UTSW 9 123656266 missense probably damaging 1.00
R8017:Slc6a20a UTSW 9 123637852 missense probably damaging 1.00
R8017:Slc6a20a UTSW 9 123664574 missense probably damaging 1.00
R8019:Slc6a20a UTSW 9 123637852 missense probably damaging 1.00
R8019:Slc6a20a UTSW 9 123664574 missense probably damaging 1.00
R8023:Slc6a20a UTSW 9 123660592 missense probably damaging 1.00
R8145:Slc6a20a UTSW 9 123637000 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTACAGACTCAGGAGGCCC -3'
(R):5'- CTGAAGGCTTGCTGTGGAAAG -3'

Sequencing Primer
(F):5'- AGACTCAGGAGGCCCCAGAC -3'
(R):5'- ATGGAGCATCACAGGCCTCTTC -3'
Posted On2018-08-29