Incidental Mutation 'R6747:B4galnt2'
ID 543572
Institutional Source Beutler Lab
Gene Symbol B4galnt2
Ensembl Gene ENSMUSG00000013418
Gene Name beta-1,4-N-acetyl-galactosaminyl transferase 2
Synonyms Galgt2, Dlb-1, Dlb1
MMRRC Submission 044864-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.107) question?
Stock # R6747 (G1)
Quality Score 50.0072
Status Validated
Chromosome 11
Chromosomal Location 95865943-95914891 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 95868634 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000037239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038343]
AlphaFold Q09199
Predicted Effect probably null
Transcript: ENSMUST00000038343
SMART Domains Protein: ENSMUSP00000037239
Gene: ENSMUSG00000013418

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
low complexity region 125 138 N/A INTRINSIC
Pfam:Glycos_transf_2 268 433 1.3e-19 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] B4GALNT2 catalyzes the last step in the biosynthesis of the human Sd(a) antigen through the addition of an N-acetylgalactosamine residue via a beta-1,4 linkage to a subterminal galactose residue substituted with an alpha-2,3-linked sialic acid. B4GALNT2 also catalyzes the last step in the biosynthesis of the Cad antigen (Montiel et al., 2003 [PubMed 12678917]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele show increased startle reflex, increased systemic arterial diastolic blood pressure, abnormal B cell number, increased neutrophil cell number, and increased circulating alkaline phosphatase level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C T 3: 122,126,313 (GRCm38) probably null Het
Acyp1 C T 12: 85,278,905 (GRCm38) V107I probably null Het
Aftph T C 11: 20,726,144 (GRCm38) probably null Het
Agtpbp1 A T 13: 59,544,353 (GRCm38) probably null Het
Arhgap15 C A 2: 44,116,677 (GRCm38) P269T probably damaging Het
Arhgap30 T C 1: 171,407,729 (GRCm38) V557A probably damaging Het
Asb3 T A 11: 31,081,493 (GRCm38) M410K probably benign Het
Birc3 A G 9: 7,860,261 (GRCm38) probably null Het
Cav2 A T 6: 17,286,951 (GRCm38) N69Y probably damaging Het
Cc2d2b G A 19: 40,795,667 (GRCm38) C826Y probably benign Het
Cenpf T A 1: 189,652,854 (GRCm38) T2410S probably benign Het
Chchd1 A G 14: 20,703,380 (GRCm38) D24G probably benign Het
Cmip G A 8: 117,436,879 (GRCm38) G450S probably benign Het
Col11a1 C T 3: 114,212,450 (GRCm38) Q534* probably null Het
Col3a1 G T 1: 45,338,622 (GRCm38) probably benign Het
Cox4i1 T C 8: 120,673,230 (GRCm38) I31T possibly damaging Het
Cstf3 G T 2: 104,646,767 (GRCm38) V168F probably damaging Het
Dapk1 T C 13: 60,725,340 (GRCm38) I352T probably benign Het
Ddx52 T C 11: 83,955,302 (GRCm38) V456A probably damaging Het
Dmxl2 A T 9: 54,416,088 (GRCm38) H1337Q probably damaging Het
Dnah7a T C 1: 53,636,062 (GRCm38) T369A probably benign Het
Dppa1 T A 11: 46,625,595 (GRCm38) I8F unknown Het
Ebf1 G T 11: 44,883,814 (GRCm38) V213F probably damaging Het
Foxb2 C A 19: 16,872,833 (GRCm38) E270* probably null Het
Gclc A T 9: 77,788,245 (GRCm38) R450W probably damaging Het
Gm13128 T C 4: 144,332,978 (GRCm38) W420R probably benign Het
Grin2d T C 7: 45,862,268 (GRCm38) E251G probably damaging Het
Hal A T 10: 93,500,677 (GRCm38) N423Y probably damaging Het
Krtap4-8 T A 11: 99,780,091 (GRCm38) I185F unknown Het
Lrp3 T A 7: 35,211,437 (GRCm38) Q61L probably benign Het
Met A C 6: 17,571,467 (GRCm38) Q1296H probably damaging Het
Mphosph9 T A 5: 124,297,699 (GRCm38) N557I possibly damaging Het
Mrpl46 C A 7: 78,782,981 (GRCm38) W16C probably benign Het
Myh13 G A 11: 67,350,419 (GRCm38) R874Q probably damaging Het
Nelfb G A 2: 25,203,381 (GRCm38) T453I probably benign Het
Nos2 A G 11: 78,952,954 (GRCm38) D909G probably damaging Het
Nr5a2 T C 1: 136,882,344 (GRCm38) E431G possibly damaging Het
Nsmce2 A G 15: 59,591,724 (GRCm38) D149G probably benign Het
Olfr203 T C 16: 59,303,641 (GRCm38) F164L probably benign Het
Olfr690 C T 7: 105,330,027 (GRCm38) R55H probably benign Het
Pcbp4 C A 9: 106,460,648 (GRCm38) probably null Het
Peg10 A G 6: 4,757,137 (GRCm38) probably benign Het
Pms2 C T 5: 143,925,419 (GRCm38) P154L probably benign Het
Pou6f2 A C 13: 18,129,187 (GRCm38) L112R probably benign Het
Prdm6 A T 18: 53,465,046 (GRCm38) probably benign Het
Prob1 G A 18: 35,655,154 (GRCm38) R12W probably damaging Het
Rif1 T A 2: 52,078,263 (GRCm38) probably null Het
Rpl9-ps6 A G 19: 32,466,143 (GRCm38) S137P probably benign Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 (GRCm38) probably benign Homo
Sec23ip A G 7: 128,752,849 (GRCm38) silent Het
Slc38a9 T C 13: 112,690,180 (GRCm38) C151R probably benign Het
Slc39a8 T C 3: 135,849,180 (GRCm38) probably null Het
Slc6a18 C A 13: 73,677,991 (GRCm38) probably benign Het
Snw1 T C 12: 87,464,710 (GRCm38) D57G probably damaging Het
Sox6 C G 7: 115,541,731 (GRCm38) R505P probably damaging Het
Speg T C 1: 75,410,395 (GRCm38) probably null Het
Spire2 C T 8: 123,356,846 (GRCm38) R190C probably damaging Het
Stard9 A C 2: 120,698,383 (GRCm38) H1707P possibly damaging Het
Tenm3 G T 8: 48,343,243 (GRCm38) T237K probably damaging Het
Themis2 T A 4: 132,796,262 (GRCm38) E31V possibly damaging Het
Trim56 T G 5: 137,114,521 (GRCm38) Q47P probably damaging Het
Trim58 T C 11: 58,651,264 (GRCm38) I350T probably benign Het
Ttll7 C T 3: 146,944,056 (GRCm38) P639S probably benign Het
Ubxn6 A G 17: 56,070,650 (GRCm38) probably null Het
Vmn2r114 A T 17: 23,309,876 (GRCm38) F417L probably benign Het
Vmn2r29 T A 7: 7,231,422 (GRCm38) M822L probably benign Het
Vps9d1 T C 8: 123,254,007 (GRCm38) D27G probably damaging Het
Wdr3 C T 3: 100,138,724 (GRCm38) R931Q probably damaging Het
Whamm G A 7: 81,578,302 (GRCm38) probably null Het
Zcchc24 T C 14: 25,757,033 (GRCm38) H142R probably damaging Het
Zfp292 T C 4: 34,806,894 (GRCm38) K2050R probably damaging Het
Other mutations in B4galnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03252:B4galnt2 APN 11 95,873,931 (GRCm38) missense probably damaging 0.99
R0594:B4galnt2 UTSW 11 95,891,909 (GRCm38) missense probably benign 0.00
R1216:B4galnt2 UTSW 11 95,891,941 (GRCm38) missense probably benign 0.02
R1344:B4galnt2 UTSW 11 95,869,355 (GRCm38) missense probably benign 0.43
R1735:B4galnt2 UTSW 11 95,890,983 (GRCm38) missense probably damaging 0.99
R4706:B4galnt2 UTSW 11 95,876,097 (GRCm38) critical splice donor site probably null
R4707:B4galnt2 UTSW 11 95,876,097 (GRCm38) critical splice donor site probably null
R4867:B4galnt2 UTSW 11 95,868,426 (GRCm38) missense probably damaging 1.00
R4937:B4galnt2 UTSW 11 95,868,429 (GRCm38) missense probably damaging 1.00
R4967:B4galnt2 UTSW 11 95,869,274 (GRCm38) missense probably benign 0.19
R5077:B4galnt2 UTSW 11 95,876,314 (GRCm38) intron probably benign
R5822:B4galnt2 UTSW 11 95,866,159 (GRCm38) missense probably damaging 1.00
R6225:B4galnt2 UTSW 11 95,868,442 (GRCm38) missense probably damaging 1.00
R6239:B4galnt2 UTSW 11 95,876,239 (GRCm38) missense probably damaging 0.99
R6653:B4galnt2 UTSW 11 95,891,921 (GRCm38) missense probably benign
R6969:B4galnt2 UTSW 11 95,891,930 (GRCm38) missense probably benign 0.02
R7448:B4galnt2 UTSW 11 95,869,367 (GRCm38) missense probably damaging 1.00
R7879:B4galnt2 UTSW 11 95,869,397 (GRCm38) missense possibly damaging 0.87
R8372:B4galnt2 UTSW 11 95,869,280 (GRCm38) missense possibly damaging 0.61
R8397:B4galnt2 UTSW 11 95,866,163 (GRCm38) missense probably benign 0.00
R8966:B4galnt2 UTSW 11 95,890,985 (GRCm38) missense probably damaging 1.00
R9253:B4galnt2 UTSW 11 95,868,350 (GRCm38) splice site silent
R9755:B4galnt2 UTSW 11 95,883,975 (GRCm38) nonsense probably null
X0009:B4galnt2 UTSW 11 95,891,061 (GRCm38) missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TCGCTGAAGAGAAAGTCATCG -3'
(R):5'- CACTGAGCGCAAATGTTCC -3'

Sequencing Primer
(F):5'- TAGTCACCTGTGAGATGGCCAG -3'
(R):5'- TGAGCGCAAATGTTCCCCAAAC -3'
Posted On 2019-03-08