Incidental Mutation 'R6747:Zfp292'
ID530573
Institutional Source Beutler Lab
Gene Symbol Zfp292
Ensembl Gene ENSMUSG00000039967
Gene Namezinc finger protein 292
SynonymsZn-16, 5730450D02Rik, Zfp15, Zn-15, Zfp-15, 9430062L07Rik, Krox-10
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.770) question?
Stock #R6747 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location34803113-34882960 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34806894 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 2050 (K2050R)
Ref Sequence ENSEMBL: ENSMUSP00000095766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047950] [ENSMUST00000098163]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047950
AA Change: K2055R

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000037233
Gene: ENSMUSG00000039967
AA Change: K2055R

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
low complexity region 101 120 N/A INTRINSIC
low complexity region 512 523 N/A INTRINSIC
ZnF_C2H2 540 561 5.12e1 SMART
ZnF_C2H2 567 589 4.72e-2 SMART
low complexity region 649 664 N/A INTRINSIC
ZnF_C2H2 681 705 3.52e-1 SMART
ZnF_C2H2 722 744 1.53e-1 SMART
ZnF_C2H2 750 774 1.62e0 SMART
ZnF_C2H2 779 803 1.08e1 SMART
ZnF_C2H2 807 831 1.95e-3 SMART
low complexity region 1062 1078 N/A INTRINSIC
ZnF_C2H2 1085 1110 7.67e-2 SMART
ZnF_C2H2 1361 1381 1.93e2 SMART
low complexity region 1606 1618 N/A INTRINSIC
ZnF_C2H2 1879 1904 4.4e-2 SMART
ZnF_C2H2 1924 1949 5.42e-2 SMART
low complexity region 2004 2014 N/A INTRINSIC
low complexity region 2024 2037 N/A INTRINSIC
coiled coil region 2050 2072 N/A INTRINSIC
ZnF_C2H2 2091 2116 4.45e0 SMART
low complexity region 2121 2143 N/A INTRINSIC
ZnF_C2H2 2149 2174 1.64e-1 SMART
ZnF_C2H2 2193 2218 3.24e0 SMART
ZnF_C2H2 2233 2258 1.18e-2 SMART
low complexity region 2301 2314 N/A INTRINSIC
ZnF_C2H2 2362 2386 2.86e-1 SMART
low complexity region 2589 2605 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098163
AA Change: K2050R

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095766
Gene: ENSMUSG00000039967
AA Change: K2050R

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
low complexity region 101 120 N/A INTRINSIC
low complexity region 507 518 N/A INTRINSIC
ZnF_C2H2 535 556 5.12e1 SMART
ZnF_C2H2 562 584 4.72e-2 SMART
low complexity region 644 659 N/A INTRINSIC
ZnF_C2H2 676 700 3.52e-1 SMART
ZnF_C2H2 717 739 1.53e-1 SMART
ZnF_C2H2 745 769 1.62e0 SMART
ZnF_C2H2 774 798 1.08e1 SMART
ZnF_C2H2 802 826 1.95e-3 SMART
low complexity region 1057 1073 N/A INTRINSIC
ZnF_C2H2 1080 1105 7.67e-2 SMART
ZnF_C2H2 1356 1376 1.93e2 SMART
low complexity region 1601 1613 N/A INTRINSIC
ZnF_C2H2 1874 1899 4.4e-2 SMART
ZnF_C2H2 1919 1944 5.42e-2 SMART
low complexity region 1999 2009 N/A INTRINSIC
low complexity region 2019 2032 N/A INTRINSIC
coiled coil region 2045 2067 N/A INTRINSIC
ZnF_C2H2 2086 2111 4.45e0 SMART
low complexity region 2116 2138 N/A INTRINSIC
ZnF_C2H2 2144 2169 1.64e-1 SMART
ZnF_C2H2 2188 2213 3.24e0 SMART
ZnF_C2H2 2228 2253 1.18e-2 SMART
low complexity region 2296 2309 N/A INTRINSIC
ZnF_C2H2 2357 2381 2.86e-1 SMART
low complexity region 2584 2600 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 97% (68/70)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C T 3: 122,126,313 probably null Het
Acyp1 C T 12: 85,278,905 V107I probably null Het
Aftph T C 11: 20,726,144 probably null Het
Agtpbp1 A T 13: 59,544,353 probably null Het
Arhgap15 C A 2: 44,116,677 P269T probably damaging Het
Arhgap30 T C 1: 171,407,729 V557A probably damaging Het
Asb3 T A 11: 31,081,493 M410K probably benign Het
B4galnt2 T C 11: 95,868,634 probably null Het
Birc3 A G 9: 7,860,261 probably null Het
Cav2 A T 6: 17,286,951 N69Y probably damaging Het
Cc2d2b G A 19: 40,795,667 C826Y probably benign Het
Cenpf T A 1: 189,652,854 T2410S probably benign Het
Chchd1 A G 14: 20,703,380 D24G probably benign Het
Cmip G A 8: 117,436,879 G450S probably benign Het
Col11a1 C T 3: 114,212,450 Q534* probably null Het
Col3a1 G T 1: 45,338,622 probably benign Het
Cox4i1 T C 8: 120,673,230 I31T possibly damaging Het
Cstf3 G T 2: 104,646,767 V168F probably damaging Het
Dapk1 T C 13: 60,725,340 I352T probably benign Het
Ddx52 T C 11: 83,955,302 V456A probably damaging Het
Dmxl2 A T 9: 54,416,088 H1337Q probably damaging Het
Dnah7a T C 1: 53,636,062 T369A probably benign Het
Dppa1 T A 11: 46,625,595 I8F unknown Het
Ebf1 G T 11: 44,883,814 V213F probably damaging Het
Foxb2 C A 19: 16,872,833 E270* probably null Het
Gclc A T 9: 77,788,245 R450W probably damaging Het
Gm13128 T C 4: 144,332,978 W420R probably benign Het
Grin2d T C 7: 45,862,268 E251G probably damaging Het
Hal A T 10: 93,500,677 N423Y probably damaging Het
Krtap4-8 T A 11: 99,780,091 I185F unknown Het
Lrp3 T A 7: 35,211,437 Q61L probably benign Het
Met A C 6: 17,571,467 Q1296H probably damaging Het
Mphosph9 T A 5: 124,297,699 N557I possibly damaging Het
Mrpl46 C A 7: 78,782,981 W16C probably benign Het
Myh13 G A 11: 67,350,419 R874Q probably damaging Het
Nelfb G A 2: 25,203,381 T453I probably benign Het
Nos2 A G 11: 78,952,954 D909G probably damaging Het
Nr5a2 T C 1: 136,882,344 E431G possibly damaging Het
Nsmce2 A G 15: 59,591,724 D149G probably benign Het
Olfr203 T C 16: 59,303,641 F164L probably benign Het
Olfr690 C T 7: 105,330,027 R55H probably benign Het
Pcbp4 C A 9: 106,460,648 probably null Het
Peg10 A G 6: 4,757,137 probably benign Het
Pms2 C T 5: 143,925,419 P154L probably benign Het
Pou6f2 A C 13: 18,129,187 L112R probably benign Het
Prdm6 A T 18: 53,465,046 probably benign Het
Prob1 G A 18: 35,655,154 R12W probably damaging Het
Rif1 T A 2: 52,078,263 probably null Het
Rpl9-ps6 A G 19: 32,466,143 S137P probably benign Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 probably benign Homo
Sec23ip A G 7: 128,752,849 silent Het
Slc38a9 T C 13: 112,690,180 C151R probably benign Het
Slc39a8 T C 3: 135,849,180 probably null Het
Slc6a18 C A 13: 73,677,991 probably benign Het
Snw1 T C 12: 87,464,710 D57G probably damaging Het
Sox6 C G 7: 115,541,731 R505P probably damaging Het
Speg T C 1: 75,410,395 probably null Het
Spire2 C T 8: 123,356,846 R190C probably damaging Het
Stard9 A C 2: 120,698,383 H1707P possibly damaging Het
Tenm3 G T 8: 48,343,243 T237K probably damaging Het
Themis2 T A 4: 132,796,262 E31V possibly damaging Het
Trim56 T G 5: 137,114,521 Q47P probably damaging Het
Trim58 T C 11: 58,651,264 I350T probably benign Het
Ttll7 C T 3: 146,944,056 P639S probably benign Het
Ubxn6 A G 17: 56,070,650 probably null Het
Vmn2r114 A T 17: 23,309,876 F417L probably benign Het
Vmn2r29 T A 7: 7,231,422 M822L probably benign Het
Vps9d1 T C 8: 123,254,007 D27G probably damaging Het
Wdr3 C T 3: 100,138,724 R931Q probably damaging Het
Whamm G A 7: 81,578,302 probably null Het
Zcchc24 T C 14: 25,757,033 H142R probably damaging Het
Other mutations in Zfp292
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Zfp292 APN 4 34808683 missense probably benign 0.15
IGL00502:Zfp292 APN 4 34809775 missense possibly damaging 0.63
IGL00539:Zfp292 APN 4 34808790 missense probably damaging 0.98
IGL00676:Zfp292 APN 4 34807827 missense probably damaging 0.99
IGL01068:Zfp292 APN 4 34806763 missense probably damaging 1.00
IGL01311:Zfp292 APN 4 34807961 missense probably benign 0.01
IGL01639:Zfp292 APN 4 34809048 missense probably benign 0.04
IGL01688:Zfp292 APN 4 34807855 missense possibly damaging 0.93
IGL02345:Zfp292 APN 4 34809244 missense possibly damaging 0.94
IGL02444:Zfp292 APN 4 34808810 missense possibly damaging 0.87
IGL02548:Zfp292 APN 4 34805416 missense probably damaging 1.00
IGL02551:Zfp292 APN 4 34806462 missense possibly damaging 0.93
IGL02702:Zfp292 APN 4 34809415 missense probably benign 0.14
IGL02715:Zfp292 APN 4 34819542 missense probably damaging 1.00
IGL03273:Zfp292 APN 4 34806163 missense probably benign 0.00
F5770:Zfp292 UTSW 4 34806783 missense possibly damaging 0.85
PIT4362001:Zfp292 UTSW 4 34807524 missense probably benign 0.00
R0153:Zfp292 UTSW 4 34811185 missense probably benign 0.26
R0184:Zfp292 UTSW 4 34819563 missense probably damaging 1.00
R0295:Zfp292 UTSW 4 34806281 missense probably damaging 1.00
R0367:Zfp292 UTSW 4 34808227 missense probably benign 0.25
R0433:Zfp292 UTSW 4 34839959 missense probably damaging 0.99
R0481:Zfp292 UTSW 4 34810059 missense probably benign 0.28
R0555:Zfp292 UTSW 4 34807194 missense probably damaging 1.00
R0597:Zfp292 UTSW 4 34807399 missense probably benign 0.02
R0748:Zfp292 UTSW 4 34816424 splice site probably benign
R0782:Zfp292 UTSW 4 34839382 missense possibly damaging 0.94
R0834:Zfp292 UTSW 4 34809114 missense probably benign 0.00
R0879:Zfp292 UTSW 4 34811218 missense probably benign 0.00
R1083:Zfp292 UTSW 4 34807569 missense probably damaging 0.98
R1343:Zfp292 UTSW 4 34805238 missense probably damaging 0.98
R1498:Zfp292 UTSW 4 34805397 missense possibly damaging 0.88
R1714:Zfp292 UTSW 4 34808935 missense probably damaging 1.00
R1724:Zfp292 UTSW 4 34811237 missense probably damaging 1.00
R1755:Zfp292 UTSW 4 34811043 missense probably benign 0.02
R1837:Zfp292 UTSW 4 34810264 missense probably damaging 0.98
R1914:Zfp292 UTSW 4 34805100 missense possibly damaging 0.92
R1915:Zfp292 UTSW 4 34805100 missense possibly damaging 0.92
R1936:Zfp292 UTSW 4 34807452 missense probably benign 0.22
R2107:Zfp292 UTSW 4 34808593 missense possibly damaging 0.86
R2108:Zfp292 UTSW 4 34808593 missense possibly damaging 0.86
R2136:Zfp292 UTSW 4 34810266 missense probably benign 0.13
R2182:Zfp292 UTSW 4 34807417 missense probably damaging 1.00
R2186:Zfp292 UTSW 4 34807962 missense probably benign 0.07
R2306:Zfp292 UTSW 4 34809468 missense probably damaging 0.96
R2350:Zfp292 UTSW 4 34811281 missense probably damaging 1.00
R2382:Zfp292 UTSW 4 34806426 missense possibly damaging 0.91
R2872:Zfp292 UTSW 4 34808595 missense probably damaging 1.00
R2872:Zfp292 UTSW 4 34808595 missense probably damaging 1.00
R3018:Zfp292 UTSW 4 34808814 missense probably damaging 0.99
R3812:Zfp292 UTSW 4 34810326 missense probably damaging 0.98
R4006:Zfp292 UTSW 4 34807744 missense probably benign 0.00
R4006:Zfp292 UTSW 4 34809611 missense possibly damaging 0.62
R4060:Zfp292 UTSW 4 34810863 missense probably damaging 1.00
R4062:Zfp292 UTSW 4 34810863 missense probably damaging 1.00
R4063:Zfp292 UTSW 4 34810863 missense probably damaging 1.00
R4064:Zfp292 UTSW 4 34810863 missense probably damaging 1.00
R4207:Zfp292 UTSW 4 34806079 missense probably benign 0.04
R4641:Zfp292 UTSW 4 34807828 missense probably damaging 0.99
R4684:Zfp292 UTSW 4 34807078 missense probably benign 0.00
R4718:Zfp292 UTSW 4 34819521 missense possibly damaging 0.92
R4865:Zfp292 UTSW 4 34819563 missense probably damaging 1.00
R4870:Zfp292 UTSW 4 34808917 missense probably damaging 1.00
R5097:Zfp292 UTSW 4 34839878 missense possibly damaging 0.89
R5233:Zfp292 UTSW 4 34809755 missense probably damaging 1.00
R5246:Zfp292 UTSW 4 34805842 missense possibly damaging 0.76
R5369:Zfp292 UTSW 4 34807491 missense possibly damaging 0.89
R5527:Zfp292 UTSW 4 34806261 missense probably damaging 1.00
R5621:Zfp292 UTSW 4 34811703 missense probably damaging 0.98
R5770:Zfp292 UTSW 4 34806747 missense probably damaging 1.00
R5900:Zfp292 UTSW 4 34805125 missense probably damaging 1.00
R5905:Zfp292 UTSW 4 34819549 missense probably damaging 1.00
R5994:Zfp292 UTSW 4 34805464 missense possibly damaging 0.87
R6028:Zfp292 UTSW 4 34819549 missense probably damaging 1.00
R6056:Zfp292 UTSW 4 34809784 missense probably damaging 1.00
R6093:Zfp292 UTSW 4 34811902 missense probably damaging 1.00
R6126:Zfp292 UTSW 4 34808497 missense probably benign 0.13
R6209:Zfp292 UTSW 4 34809442 missense probably benign 0.14
R6275:Zfp292 UTSW 4 34808883 missense possibly damaging 0.93
R6523:Zfp292 UTSW 4 34816301 missense probably benign 0.21
R6752:Zfp292 UTSW 4 34808593 missense possibly damaging 0.86
R6967:Zfp292 UTSW 4 34807812 missense probably damaging 1.00
R7038:Zfp292 UTSW 4 34816357 missense probably damaging 1.00
R7056:Zfp292 UTSW 4 34809784 missense probably damaging 1.00
R7088:Zfp292 UTSW 4 34806796 missense probably damaging 1.00
R7158:Zfp292 UTSW 4 34808679 missense probably benign
R7254:Zfp292 UTSW 4 34819476 missense probably damaging 0.98
R7350:Zfp292 UTSW 4 34806839 missense probably benign
R7378:Zfp292 UTSW 4 34808384 missense probably benign 0.26
R7535:Zfp292 UTSW 4 34811487 missense probably benign 0.28
R7589:Zfp292 UTSW 4 34806777 missense probably damaging 1.00
R7816:Zfp292 UTSW 4 34809865 missense probably benign 0.02
R7979:Zfp292 UTSW 4 34809198 missense probably benign 0.02
R7997:Zfp292 UTSW 4 34808688 missense probably damaging 0.96
R8129:Zfp292 UTSW 4 34807386 missense probably damaging 1.00
R8211:Zfp292 UTSW 4 34806163 missense probably benign 0.00
R8302:Zfp292 UTSW 4 34810893 missense possibly damaging 0.64
R8500:Zfp292 UTSW 4 34826691 critical splice donor site probably null
R8709:Zfp292 UTSW 4 34805982 missense probably damaging 1.00
V7580:Zfp292 UTSW 4 34806783 missense possibly damaging 0.85
V7581:Zfp292 UTSW 4 34806783 missense possibly damaging 0.85
V7582:Zfp292 UTSW 4 34806783 missense possibly damaging 0.85
V7583:Zfp292 UTSW 4 34806783 missense possibly damaging 0.85
Z1177:Zfp292 UTSW 4 34811058 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCAACCTCTGCAGAAAATGTAGG -3'
(R):5'- GTCACAACCAGCCTTCAAGG -3'

Sequencing Primer
(F):5'- TGTACAGCCTGGTAATGAAGAATC -3'
(R):5'- GCCTTCAAGGTACCAGCAG -3'
Posted On2018-08-01