Incidental Mutation 'R7101:Wdfy4'
ID550854
Institutional Source Beutler Lab
Gene Symbol Wdfy4
Ensembl Gene ENSMUSG00000051506
Gene NameWD repeat and FYVE domain containing 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7101 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location32959547-33185508 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 32960820 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 3136 (R3136Q)
Ref Sequence ENSEMBL: ENSMUSP00000117068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061753] [ENSMUST00000130509]
Predicted Effect probably damaging
Transcript: ENSMUST00000061753
AA Change: R2977Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000057556
Gene: ENSMUSG00000051506
AA Change: R2977Q

DomainStartEndE-ValueType
low complexity region 69 77 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
low complexity region 508 522 N/A INTRINSIC
low complexity region 618 632 N/A INTRINSIC
low complexity region 644 661 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
low complexity region 1899 1909 N/A INTRINSIC
Pfam:PH_BEACH 2237 2348 1.2e-9 PFAM
Beach 2378 2660 3.69e-196 SMART
WD40 2761 2801 1.98e1 SMART
WD40 2811 2850 5.18e-7 SMART
WD40 2853 2891 9.94e-1 SMART
WD40 2893 2940 3.17e-2 SMART
WD40 2986 3021 3.31e0 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000117068
Gene: ENSMUSG00000051506
AA Change: R3136Q

DomainStartEndE-ValueType
low complexity region 69 77 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
low complexity region 508 522 N/A INTRINSIC
low complexity region 618 632 N/A INTRINSIC
low complexity region 644 661 N/A INTRINSIC
low complexity region 1596 1615 N/A INTRINSIC
low complexity region 1795 1819 N/A INTRINSIC
low complexity region 2019 2029 N/A INTRINSIC
Pfam:PH_BEACH 2362 2473 1.2e-9 PFAM
Beach 2503 2785 3.69e-196 SMART
WD40 2886 2926 1.98e1 SMART
WD40 2936 2975 5.18e-7 SMART
WD40 2978 3016 9.94e-1 SMART
WD40 3018 3065 3.17e-2 SMART
WD40 3111 3146 3.31e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik G T 14: 8,511,171 S414R possibly damaging Het
Adam25 A G 8: 40,755,401 D568G probably benign Het
Angpt1 T C 15: 42,523,569 I130V probably benign Het
Ankrd11 G T 8: 122,895,455 Q553K probably benign Het
Ankrd42 A T 7: 92,631,544 H59Q possibly damaging Het
Ankrd52 C T 10: 128,382,380 R318C probably damaging Het
Arrdc5 G A 17: 56,294,522 T201M probably damaging Het
Atxn1l A G 8: 109,732,500 S377P probably benign Het
Baz2a T C 10: 128,121,187 F936S possibly damaging Het
Bicc1 T C 10: 70,930,653 D913G probably damaging Het
Blnk T A 19: 40,972,638 M21L probably benign Het
Cabin1 T C 10: 75,751,567 H132R probably benign Het
Ccdc154 A G 17: 25,163,468 H88R probably benign Het
Clic5 G T 17: 44,275,292 A223S probably benign Het
Col28a1 T A 6: 8,014,795 Y870F possibly damaging Het
Dhx37 G A 5: 125,424,942 Q497* probably null Het
Dnah11 T C 12: 118,068,145 T1763A probably benign Het
Dnajc13 T C 9: 104,165,022 R2005G possibly damaging Het
Dopey1 G A 9: 86,507,669 G541S probably benign Het
Drosha C T 15: 12,865,067 T627M probably damaging Het
Ephb3 C T 16: 21,218,518 H455Y possibly damaging Het
Eri1 A C 8: 35,482,623 C127G probably damaging Het
Faf1 A T 4: 109,925,956 E548D probably benign Het
Gm3285 C A 10: 77,862,360 C114* probably null Het
Gm9736 C T 10: 77,751,333 V8I unknown Het
Gnptab A T 10: 88,440,312 M1154L probably benign Het
Grin1 G A 2: 25,296,635 T770M probably damaging Het
Haus1 A G 18: 77,766,870 S67P possibly damaging Het
Homer1 C A 13: 93,356,054 Q184K probably benign Het
Hook2 A G 8: 84,997,051 T401A probably benign Het
Il6st G A 13: 112,495,373 probably null Het
Kcnh8 A T 17: 52,905,010 D612V probably damaging Het
Ltbr C G 6: 125,312,800 E144Q probably benign Het
Mcf2l G T 8: 13,013,579 R961L possibly damaging Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Myo1b G T 1: 51,758,001 Q961K probably benign Het
Myo1h C A 5: 114,342,197 T531N Het
Ngly1 G A 14: 16,283,445 R408Q probably damaging Het
Nup133 T C 8: 123,906,227 E1055G possibly damaging Het
Nutm2 A G 13: 50,472,898 K363R probably benign Het
Obox8 A T 7: 14,332,827 Y97* probably null Het
Odc1 A G 12: 17,547,318 D7G probably benign Het
Ogfod2 C T 5: 124,114,495 T182I unknown Het
Olfr1216 A T 2: 89,013,980 V28E possibly damaging Het
Olfr331 A G 11: 58,502,553 M7T probably benign Het
Olfr875 T C 9: 37,772,991 S111P probably damaging Het
Olfr910 G A 9: 38,539,670 M258I probably benign Het
Parp4 A G 14: 56,589,973 D188G probably benign Het
Phactr2 T C 10: 13,247,178 E400G probably benign Het
Phlpp1 G A 1: 106,172,667 V222M possibly damaging Het
Ppp1r16b T C 2: 158,761,763 V536A probably damaging Het
Prex2 T C 1: 11,153,609 V719A possibly damaging Het
Prpf8 C T 11: 75,490,400 A242V possibly damaging Het
Prr14l A G 5: 32,829,427 L908P probably damaging Het
Prrc2b A G 2: 32,226,993 N2146D possibly damaging Het
Rtkn T C 6: 83,150,012 V333A possibly damaging Het
Samd8 T C 14: 21,775,374 Y196H probably benign Het
Six5 A G 7: 19,094,859 T75A probably benign Het
Slc35a4 T A 18: 36,681,538 L42H probably damaging Het
Svs3a A T 2: 164,290,013 D168V probably damaging Het
Themis T A 10: 28,761,426 Y175* probably null Het
Tspan33 G T 6: 29,716,784 R180L probably benign Het
Ttc28 C T 5: 111,085,092 S145F probably damaging Het
Txn2 G A 15: 77,926,678 T102I unknown Het
Usp34 T A 11: 23,426,183 V1908E Het
Vmn2r101 A G 17: 19,589,088 I160V probably null Het
Vmn2r104 A T 17: 20,030,096 C638S possibly damaging Het
Zan C A 5: 137,398,290 A4335S unknown Het
Zfp180 G T 7: 24,104,533 V126F probably benign Het
Zfp429 T A 13: 67,390,812 D171V possibly damaging Het
Zfp638 T C 6: 83,954,726 I798T probably benign Het
Other mutations in Wdfy4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Wdfy4 APN 14 33102539 missense possibly damaging 0.93
IGL01116:Wdfy4 APN 14 32959977 missense probably damaging 1.00
IGL01449:Wdfy4 APN 14 33104037 missense probably damaging 0.99
IGL01567:Wdfy4 APN 14 33151661 missense probably benign 0.01
IGL01700:Wdfy4 APN 14 33020238 splice site probably benign
IGL01931:Wdfy4 APN 14 33155753 missense probably damaging 1.00
IGL01981:Wdfy4 APN 14 33133716 missense probably damaging 1.00
IGL01988:Wdfy4 APN 14 33076480 missense possibly damaging 0.75
IGL02026:Wdfy4 APN 14 33093300 missense probably damaging 1.00
IGL02066:Wdfy4 APN 14 33149566 missense probably benign
IGL02468:Wdfy4 APN 14 32966432 missense probably benign 0.01
IGL02512:Wdfy4 APN 14 33042491 missense probably benign 0.01
IGL02597:Wdfy4 APN 14 33090861 nonsense probably null
IGL02752:Wdfy4 APN 14 33076326 missense probably damaging 1.00
IGL02792:Wdfy4 APN 14 33095305 missense probably benign 0.01
IGL02826:Wdfy4 APN 14 32971750 missense possibly damaging 0.47
IGL02903:Wdfy4 APN 14 33109650 missense probably damaging 1.00
IGL02955:Wdfy4 APN 14 33076284 missense probably damaging 1.00
IGL03031:Wdfy4 APN 14 33140651 missense probably damaging 1.00
IGL03102:Wdfy4 APN 14 32966435 missense probably damaging 1.00
IGL03123:Wdfy4 APN 14 33162870 missense probably benign 0.01
IGL03198:Wdfy4 APN 14 33125887 missense probably damaging 1.00
IGL03250:Wdfy4 APN 14 32977167 missense probably damaging 0.99
IGL03277:Wdfy4 APN 14 33068904 missense probably benign 0.01
IGL03398:Wdfy4 APN 14 33047290 missense probably benign 0.14
Dollar UTSW 14 33020311 missense probably damaging 1.00
Giants UTSW 14 33070618 nonsense probably null
kings_canyon UTSW 14 33109519 nonsense probably null
moro UTSW 14 32964626 splice site probably null
sequoia UTSW 14 33100903 critical splice donor site probably null
Sherman UTSW 14 33095951 missense possibly damaging 0.89
watchtower UTSW 14 33083639 critical splice donor site probably null
R0014:Wdfy4 UTSW 14 33107173 missense possibly damaging 0.72
R0067:Wdfy4 UTSW 14 33162751 missense probably null 1.00
R0085:Wdfy4 UTSW 14 33078243 missense possibly damaging 0.81
R0277:Wdfy4 UTSW 14 33083785 missense possibly damaging 0.83
R0436:Wdfy4 UTSW 14 33083812 splice site probably benign
R0496:Wdfy4 UTSW 14 33140738 splice site probably benign
R0514:Wdfy4 UTSW 14 33080775 missense probably benign 0.22
R0548:Wdfy4 UTSW 14 33042621 missense probably benign
R0590:Wdfy4 UTSW 14 33041174 missense probably benign 0.09
R0647:Wdfy4 UTSW 14 33109699 missense possibly damaging 0.96
R0766:Wdfy4 UTSW 14 33140612 missense probably damaging 1.00
R0981:Wdfy4 UTSW 14 33147092 missense probably benign 0.03
R1024:Wdfy4 UTSW 14 33079966 missense possibly damaging 0.81
R1113:Wdfy4 UTSW 14 32971738 missense possibly damaging 0.47
R1252:Wdfy4 UTSW 14 32971772 splice site probably null
R1415:Wdfy4 UTSW 14 33041180 missense possibly damaging 0.60
R1475:Wdfy4 UTSW 14 33108688 missense probably benign 0.14
R1483:Wdfy4 UTSW 14 33100966 missense probably benign 0.41
R1490:Wdfy4 UTSW 14 33152538 critical splice donor site probably null
R1512:Wdfy4 UTSW 14 32960808 missense probably damaging 0.98
R1615:Wdfy4 UTSW 14 33042512 missense probably damaging 1.00
R1628:Wdfy4 UTSW 14 32959961 missense probably damaging 1.00
R1643:Wdfy4 UTSW 14 33073585 critical splice acceptor site probably null
R1729:Wdfy4 UTSW 14 33096005 missense possibly damaging 0.85
R1859:Wdfy4 UTSW 14 33103983 missense probably damaging 0.99
R1933:Wdfy4 UTSW 14 33133344 missense probably benign 0.08
R1957:Wdfy4 UTSW 14 32971684 missense probably damaging 1.00
R1968:Wdfy4 UTSW 14 33106044 missense possibly damaging 0.95
R2032:Wdfy4 UTSW 14 33146989 missense probably benign 0.11
R2241:Wdfy4 UTSW 14 33073511 missense possibly damaging 0.81
R2391:Wdfy4 UTSW 14 33162807 missense possibly damaging 0.92
R2888:Wdfy4 UTSW 14 33109519 nonsense probably null
R2889:Wdfy4 UTSW 14 33109519 nonsense probably null
R3114:Wdfy4 UTSW 14 33089903 missense probably damaging 0.97
R3757:Wdfy4 UTSW 14 33023374 missense probably benign 0.17
R3758:Wdfy4 UTSW 14 33023374 missense probably benign 0.17
R3797:Wdfy4 UTSW 14 33140645 missense probably damaging 1.00
R3890:Wdfy4 UTSW 14 33047280 missense probably damaging 1.00
R3892:Wdfy4 UTSW 14 33047280 missense probably damaging 1.00
R3945:Wdfy4 UTSW 14 32966395 missense probably damaging 0.99
R4011:Wdfy4 UTSW 14 33102680 splice site probably benign
R4091:Wdfy4 UTSW 14 33125880 missense possibly damaging 0.93
R4449:Wdfy4 UTSW 14 33096083 missense probably damaging 1.00
R4585:Wdfy4 UTSW 14 33087955 missense possibly damaging 0.89
R4628:Wdfy4 UTSW 14 33102558 missense probably damaging 0.97
R4629:Wdfy4 UTSW 14 33102558 missense probably damaging 0.97
R4655:Wdfy4 UTSW 14 32989936 missense probably damaging 0.98
R4689:Wdfy4 UTSW 14 33109548 missense possibly damaging 0.88
R4718:Wdfy4 UTSW 14 33145316 missense probably benign 0.03
R4862:Wdfy4 UTSW 14 33100903 critical splice donor site probably null
R4884:Wdfy4 UTSW 14 32988895 nonsense probably null
R4894:Wdfy4 UTSW 14 33155760 missense probably benign 0.03
R4929:Wdfy4 UTSW 14 33047256 missense possibly damaging 0.90
R4932:Wdfy4 UTSW 14 33029013 missense probably damaging 1.00
R5014:Wdfy4 UTSW 14 33100940 missense probably benign 0.02
R5020:Wdfy4 UTSW 14 33079935 missense probably damaging 1.00
R5049:Wdfy4 UTSW 14 33152670 missense possibly damaging 0.78
R5276:Wdfy4 UTSW 14 33047275 missense probably damaging 1.00
R5318:Wdfy4 UTSW 14 33078343 missense possibly damaging 0.95
R5338:Wdfy4 UTSW 14 33090866 missense probably damaging 1.00
R5349:Wdfy4 UTSW 14 32988899 missense probably damaging 1.00
R5411:Wdfy4 UTSW 14 32960002 missense probably damaging 1.00
R5435:Wdfy4 UTSW 14 33020311 missense probably damaging 1.00
R5463:Wdfy4 UTSW 14 33151732 missense probably benign 0.17
R5591:Wdfy4 UTSW 14 33107130 missense probably benign 0.09
R5598:Wdfy4 UTSW 14 33133497 missense probably damaging 1.00
R5654:Wdfy4 UTSW 14 33107618 splice site probably null
R5890:Wdfy4 UTSW 14 33102577 missense possibly damaging 0.91
R5894:Wdfy4 UTSW 14 33133360 missense possibly damaging 0.86
R5964:Wdfy4 UTSW 14 33106011 missense probably damaging 1.00
R6036:Wdfy4 UTSW 14 33146990 missense probably damaging 0.97
R6036:Wdfy4 UTSW 14 33146990 missense probably damaging 0.97
R6074:Wdfy4 UTSW 14 33083639 critical splice donor site probably null
R6135:Wdfy4 UTSW 14 32971711 missense probably damaging 0.99
R6276:Wdfy4 UTSW 14 33109525 missense possibly damaging 0.54
R6357:Wdfy4 UTSW 14 33101049 nonsense probably null
R6370:Wdfy4 UTSW 14 33068850 missense probably benign 0.16
R6390:Wdfy4 UTSW 14 33104094 missense probably damaging 0.99
R6413:Wdfy4 UTSW 14 32967647 missense probably damaging 1.00
R6450:Wdfy4 UTSW 14 33108692 missense probably damaging 1.00
R6522:Wdfy4 UTSW 14 33146944 missense probably damaging 0.98
R6657:Wdfy4 UTSW 14 33047251 missense possibly damaging 0.70
R6761:Wdfy4 UTSW 14 33095951 missense possibly damaging 0.89
R6763:Wdfy4 UTSW 14 33042512 missense probably damaging 1.00
R6952:Wdfy4 UTSW 14 32959966 missense probably damaging 1.00
R6985:Wdfy4 UTSW 14 33099117 missense possibly damaging 0.68
R7024:Wdfy4 UTSW 14 32964626 splice site probably null
R7114:Wdfy4 UTSW 14 32971574 splice site probably null
R7139:Wdfy4 UTSW 14 33151578 missense
R7255:Wdfy4 UTSW 14 32974282 missense
R7324:Wdfy4 UTSW 14 33047314 missense
R7379:Wdfy4 UTSW 14 33151609 missense
R7399:Wdfy4 UTSW 14 33068906 missense
R7408:Wdfy4 UTSW 14 33078307 missense
R7410:Wdfy4 UTSW 14 32974234 missense
R7411:Wdfy4 UTSW 14 33106131 missense
R7412:Wdfy4 UTSW 14 33149584 missense
R7445:Wdfy4 UTSW 14 33070618 nonsense probably null
R7595:Wdfy4 UTSW 14 32974154 critical splice donor site probably null
R7618:Wdfy4 UTSW 14 32985739 missense
R7622:Wdfy4 UTSW 14 33078274 missense
R7828:Wdfy4 UTSW 14 32988921 missense possibly damaging 0.90
R7888:Wdfy4 UTSW 14 33090963 missense
R7971:Wdfy4 UTSW 14 33090963 missense
R8001:Wdfy4 UTSW 14 32973535 critical splice donor site probably null
R8010:Wdfy4 UTSW 14 32971627 missense
R8015:Wdfy4 UTSW 14 33107747 missense
R8032:Wdfy4 UTSW 14 33029086 nonsense probably null
R8041:Wdfy4 UTSW 14 33154008 critical splice donor site probably null
X0028:Wdfy4 UTSW 14 33080636 missense probably benign
X0053:Wdfy4 UTSW 14 33162942 start codon destroyed probably null 0.99
X0062:Wdfy4 UTSW 14 33107618 splice site probably null
Z1177:Wdfy4 UTSW 14 33087985 missense
Predicted Primers PCR Primer
(F):5'- GAACCCAGCTGGAAATGTTG -3'
(R):5'- TGCAAATTAAATTGGGACGGCC -3'

Sequencing Primer
(F):5'- CCAGCTGGAAATGTTGGGACTTG -3'
(R):5'- TTTTTGCAACAGCACAGGC -3'
Posted On2019-05-15