Mutagenetix > Incidental Mutations

Incidental Mutation 'R7164:Cfap206'

557786

Institutional Source

Beutler Lab

Gene Symbol

Cfap206

Ensembl Gene

ENSMUSG00000028294

Gene Name

cilia and flagella associated protein 206

Synonyms

1700003M02Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.307) question?

Stock #

R7164 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

34688559-34730206 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 34719656 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 253 (M253L)

Ref Sequence

ENSEMBL: ENSMUSP00000103771 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029971] [ENSMUST00000108136] [ENSMUST00000137514] [ENSMUST00000162495]

AlphaFold

Q6PE87

Predicted Effect

probably benign
Transcript: ENSMUST00000029971
AA Change: M253L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000029971
Gene: ENSMUSG00000028294
AA Change: M253L

Domain	Start	End	E-Value	Type
Pfam:DUF3508	214	491	6.1e-108	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000108136
AA Change: M253L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000103771
Gene: ENSMUSG00000028294
AA Change: M253L

Domain	Start	End	E-Value	Type
Pfam:DUF3508	213	493	3.8e-127	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000137514

Predicted Effect

probably benign
Transcript: ENSMUST00000162495

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (59/59)

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610037L13Rik	C	A	4: 107,894,890	D155E	not run	Het
4932415D10Rik	G	A	10: 82,286,229	T3649I	probably damaging	Het
Actn2	G	A	13: 12,278,961	H558Y	probably damaging	Het
Akap9	G	C	5: 4,060,364	E3022D	probably damaging	Het
Anapc2	C	T	2: 25,284,999	R710C	probably damaging	Het
Bcl6	G	A	16: 23,966,226	R675*	probably null	Het
Carmil3	A	G	14: 55,501,282	E844G	probably damaging	Het
Cdk17	T	G	10: 93,232,481	S367A	probably benign	Het
Chd3	T	G	11: 69,362,306	K228Q	probably damaging	Het
Cit	T	A	5: 115,985,787	I1503N	possibly damaging	Het
Csn1s1	A	G	5: 87,674,228	N119S	possibly damaging	Het
Degs1	A	G	1: 182,279,125	S226P	probably damaging	Het
Espl1	T	C	15: 102,313,203	W976R	probably damaging	Het
Fbxl4	C	T	4: 22,386,218	P275L	probably benign	Het
Flnb	A	G	14: 7,915,944		probably null	Het
Gm996	T	A	2: 25,578,567	H444L	possibly damaging	Het
Gnptab	T	A	10: 88,434,070	Y878*	probably null	Het
Gpr89	A	T	3: 96,871,398	M453K	probably benign	Het
Igsf5	A	T	16: 96,372,848	Q26L	possibly damaging	Het
Inpp5e	T	A	2: 26,407,983	D202V	possibly damaging	Het
Itga3	C	T	11: 95,052,479	V931M	possibly damaging	Het
Kcnab3	T	C	11: 69,331,358		probably null	Het
Klk4	T	C	7: 43,881,698	I17T	possibly damaging	Het
Lrrc73	T	C	17: 46,256,243	L206P	probably damaging	Het
Manba	A	T	3: 135,542,388	N346I	probably damaging	Het
Map4k4	T	C	1: 39,973,972	Y76H	possibly damaging	Het
Map4k5	T	C	12: 69,830,436	T312A	probably benign	Het
Masp2	A	G	4: 148,610,115		probably null	Het
Mast1	T	C	8: 84,935,304	D63G	possibly damaging	Het
Mtf2	T	A	5: 108,093,369	S254T	possibly damaging	Het
Myo16	A	T	8: 10,569,585	T1379S	unknown	Het
Myo5a	A	G	9: 75,180,153	E1097G	probably benign	Het
Nat1	T	C	8: 67,491,677	V238A	possibly damaging	Het
Nhlrc2	A	G	19: 56,592,499	D493G	probably damaging	Het
Olfr1165-ps	T	C	2: 88,101,832	K52E	probably damaging	Het
Olfr1331	C	T	4: 118,869,725	P315S	probably benign	Het
Olfr1462	A	T	19: 13,190,906	M80L	probably benign	Het
Olfr291	A	G	7: 84,857,043	I227V	possibly damaging	Het
Olfr50	T	C	2: 36,793,697	S154P	probably benign	Het
Olfr919	A	G	9: 38,698,219	I49T	possibly damaging	Het
Pcsk5	C	T	19: 17,451,985	C1543Y	probably damaging	Het
Pde4d	A	G	13: 109,032,688	D88G	probably benign	Het
Pld5	A	T	1: 176,213,621	M1K	probably null	Het
Prmt6	A	G	3: 110,250,364	M203T	probably benign	Het
Prr14l	A	T	5: 32,829,166	V995D	probably damaging	Het
Psg18	T	C	7: 18,350,937	E199G	possibly damaging	Het
Pth1r	A	G	9: 110,723,747	I439T	possibly damaging	Het
Ptprc	T	A	1: 138,117,862	I87F	probably benign	Het
Slc44a1	T	C	4: 53,528,711	S154P	probably benign	Het
Slco1c1	T	A	6: 141,542,129	Y192*	probably null	Het
Spag16	A	G	1: 70,724,866	H615R	possibly damaging	Het
Tas2r114	G	A	6: 131,689,765	A100V	possibly damaging	Het
U2af1l4	T	C	7: 30,565,119	S103P	probably benign	Het
Usp10	T	C	8: 119,942,108	S383P	probably damaging	Het
Vmn2r113	A	G	17: 22,948,163	R505G	probably benign	Het
Vmn2r75	A	C	7: 86,165,384	D300E	probably damaging	Het
Zfp318	T	A	17: 46,397,306		probably null	Het
Zfp318	T	C	17: 46,405,939	V999A	probably damaging	Het
Zfp324	A	T	7: 12,968,883	H58L	probably damaging	Het
Zfp707	A	G	15: 75,975,118	E339G	possibly damaging	Het

Other mutations in Cfap206

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00797:Cfap206	APN	4	34721562	missense	probably damaging	1.00
IGL00798:Cfap206	APN	4	34721562	missense	probably damaging	1.00
IGL00826:Cfap206	APN	4	34721562	missense	probably damaging	1.00
IGL00919:Cfap206	APN	4	34721562	missense	probably damaging	1.00
IGL01062:Cfap206	APN	4	34721562	missense	probably damaging	1.00
IGL01064:Cfap206	APN	4	34721562	missense	probably damaging	1.00
IGL01069:Cfap206	APN	4	34721562	missense	probably damaging	1.00
IGL01070:Cfap206	APN	4	34721562	missense	probably damaging	1.00
IGL01086:Cfap206	APN	4	34721562	missense	probably damaging	1.00
IGL01087:Cfap206	APN	4	34721562	missense	probably damaging	1.00
IGL01090:Cfap206	APN	4	34721562	missense	probably damaging	1.00
IGL01098:Cfap206	APN	4	34721562	missense	probably damaging	1.00
IGL01111:Cfap206	APN	4	34721562	missense	probably damaging	1.00
IGL01133:Cfap206	APN	4	34721562	missense	probably damaging	1.00
IGL01135:Cfap206	APN	4	34721562	missense	probably damaging	1.00
IGL01147:Cfap206	APN	4	34721562	missense	probably damaging	1.00
IGL01152:Cfap206	APN	4	34721562	missense	probably damaging	1.00
IGL01153:Cfap206	APN	4	34721562	missense	probably damaging	1.00
IGL01154:Cfap206	APN	4	34721562	missense	probably damaging	1.00
IGL01155:Cfap206	APN	4	34721562	missense	probably damaging	1.00
IGL01289:Cfap206	APN	4	34716469	missense	probably null	0.98
IGL01845:Cfap206	APN	4	34719610	missense	possibly damaging	0.57
IGL02115:Cfap206	APN	4	34722623	missense	possibly damaging	0.54
IGL03241:Cfap206	APN	4	34711553	missense	probably damaging	1.00
IGL03405:Cfap206	APN	4	34716445	missense	possibly damaging	0.82
ANU05:Cfap206	UTSW	4	34721562	missense	probably damaging	1.00
BB001:Cfap206	UTSW	4	34728833	missense	probably benign	0.10
BB011:Cfap206	UTSW	4	34728833	missense	probably benign	0.10
R0012:Cfap206	UTSW	4	34714519	missense	possibly damaging	0.76
R0689:Cfap206	UTSW	4	34722668	missense	probably benign	0.23
R0730:Cfap206	UTSW	4	34711391	missense	probably benign
R1567:Cfap206	UTSW	4	34716490	missense	probably benign	0.01
R1694:Cfap206	UTSW	4	34719058	missense	probably damaging	1.00
R1706:Cfap206	UTSW	4	34688875	missense	probably damaging	1.00
R1837:Cfap206	UTSW	4	34728813	missense	probably damaging	1.00
R1909:Cfap206	UTSW	4	34722714	missense	probably benign
R2098:Cfap206	UTSW	4	34719053	nonsense	probably null
R2568:Cfap206	UTSW	4	34711566	nonsense	probably null
R3125:Cfap206	UTSW	4	34716310	missense	possibly damaging	0.48
R3784:Cfap206	UTSW	4	34716445	missense	probably damaging	0.99
R5249:Cfap206	UTSW	4	34714502	missense	probably benign
R5483:Cfap206	UTSW	4	34711404	missense	probably benign	0.39
R5569:Cfap206	UTSW	4	34724892	missense	probably damaging	1.00
R6247:Cfap206	UTSW	4	34692530	missense	probably benign
R6555:Cfap206	UTSW	4	34719049	missense	probably damaging	1.00
R6791:Cfap206	UTSW	4	34711414	missense	possibly damaging	0.76
R6865:Cfap206	UTSW	4	34714448	missense	possibly damaging	0.57
R7814:Cfap206	UTSW	4	34716347	missense	probably benign	0.01
R7924:Cfap206	UTSW	4	34728833	missense	probably benign	0.10
R8092:Cfap206	UTSW	4	34728897	missense	possibly damaging	0.62
R8240:Cfap206	UTSW	4	34728902	start codon destroyed	probably null	1.00
R8323:Cfap206	UTSW	4	34719647	missense	probably benign	0.00
R8969:Cfap206	UTSW	4	34692522	missense	probably benign	0.00
R9144:Cfap206	UTSW	4	34722667	missense	possibly damaging	0.81
R9336:Cfap206	UTSW	4	34716494	missense	probably benign
Z1176:Cfap206	UTSW	4	34719661	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- GAACTTCCTGAGGTTGCCAC -3'
(R):5'- TGGGGCTACAAAAGACATTCC -3'

Sequencing Primer
(F):5'- GTTGCCACCTTTGGGAGTCAC -3'
(R):5'- AGACTCCCAGCTTCAGAT -3'

Posted On

2019-06-26