Incidental Mutation 'R7164:4932415D10Rik'
ID557811
Institutional Source Beutler Lab
Gene Symbol 4932415D10Rik
Ensembl Gene ENSMUSG00000044581
Gene NameRIKEN cDNA 4932415D10 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R7164 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location82282116-82316582 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 82286229 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 3649 (T3649I)
Ref Sequence ENSEMBL: ENSMUSP00000151425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171401] [ENSMUST00000217661]
Predicted Effect probably benign
Transcript: ENSMUST00000171401
SMART Domains Protein: ENSMUSP00000126178
Gene: ENSMUSG00000044581

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 241 263 N/A INTRINSIC
low complexity region 387 405 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000217661
AA Change: T3649I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik C A 4: 107,894,890 D155E not run Het
Actn2 G A 13: 12,278,961 H558Y probably damaging Het
Akap9 G C 5: 4,060,364 E3022D probably damaging Het
Anapc2 C T 2: 25,284,999 R710C probably damaging Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Carmil3 A G 14: 55,501,282 E844G probably damaging Het
Cdk17 T G 10: 93,232,481 S367A probably benign Het
Cfap206 T A 4: 34,719,656 M253L probably benign Het
Chd3 T G 11: 69,362,306 K228Q probably damaging Het
Cit T A 5: 115,985,787 I1503N possibly damaging Het
Csn1s1 A G 5: 87,674,228 N119S possibly damaging Het
Degs1 A G 1: 182,279,125 S226P probably damaging Het
Espl1 T C 15: 102,313,203 W976R probably damaging Het
Fbxl4 C T 4: 22,386,218 P275L probably benign Het
Flnb A G 14: 7,915,944 probably null Het
Gm996 T A 2: 25,578,567 H444L possibly damaging Het
Gnptab T A 10: 88,434,070 Y878* probably null Het
Gpr89 A T 3: 96,871,398 M453K probably benign Het
Igsf5 A T 16: 96,372,848 Q26L possibly damaging Het
Inpp5e T A 2: 26,407,983 D202V possibly damaging Het
Itga3 C T 11: 95,052,479 V931M possibly damaging Het
Kcnab3 T C 11: 69,331,358 probably null Het
Klk4 T C 7: 43,881,698 I17T possibly damaging Het
Lrrc73 T C 17: 46,256,243 L206P probably damaging Het
Manba A T 3: 135,542,388 N346I probably damaging Het
Map4k4 T C 1: 39,973,972 Y76H possibly damaging Het
Map4k5 T C 12: 69,830,436 T312A probably benign Het
Masp2 A G 4: 148,610,115 probably null Het
Mast1 T C 8: 84,935,304 D63G possibly damaging Het
Mtf2 T A 5: 108,093,369 S254T possibly damaging Het
Myo16 A T 8: 10,569,585 T1379S unknown Het
Myo5a A G 9: 75,180,153 E1097G probably benign Het
Nat1 T C 8: 67,491,677 V238A possibly damaging Het
Nhlrc2 A G 19: 56,592,499 D493G probably damaging Het
Olfr1165-ps T C 2: 88,101,832 K52E probably damaging Het
Olfr1331 C T 4: 118,869,725 P315S probably benign Het
Olfr1462 A T 19: 13,190,906 M80L probably benign Het
Olfr291 A G 7: 84,857,043 I227V possibly damaging Het
Olfr50 T C 2: 36,793,697 S154P probably benign Het
Olfr919 A G 9: 38,698,219 I49T possibly damaging Het
Pcsk5 C T 19: 17,451,985 C1543Y probably damaging Het
Pde4d A G 13: 109,032,688 D88G probably benign Het
Pld5 A T 1: 176,213,621 M1K probably null Het
Prmt6 A G 3: 110,250,364 M203T probably benign Het
Prr14l A T 5: 32,829,166 V995D probably damaging Het
Psg18 T C 7: 18,350,937 E199G possibly damaging Het
Pth1r A G 9: 110,723,747 I439T possibly damaging Het
Ptprc T A 1: 138,117,862 I87F probably benign Het
Slc44a1 T C 4: 53,528,711 S154P probably benign Het
Slco1c1 T A 6: 141,542,129 Y192* probably null Het
Spag16 A G 1: 70,724,866 H615R possibly damaging Het
Tas2r114 G A 6: 131,689,765 A100V possibly damaging Het
U2af1l4 T C 7: 30,565,119 S103P probably benign Het
Usp10 T C 8: 119,942,108 S383P probably damaging Het
Vmn2r113 A G 17: 22,948,163 R505G probably benign Het
Vmn2r75 A C 7: 86,165,384 D300E probably damaging Het
Zfp318 T A 17: 46,397,306 probably null Het
Zfp318 T C 17: 46,405,939 V999A probably damaging Het
Zfp324 A T 7: 12,968,883 H58L probably damaging Het
Zfp707 A G 15: 75,975,118 E339G possibly damaging Het
Other mutations in 4932415D10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:4932415D10Rik APN 10 82283752 missense probably benign 0.06
IGL01457:4932415D10Rik APN 10 82284734 missense probably damaging 1.00
IGL01540:4932415D10Rik APN 10 82284182 missense possibly damaging 0.87
IGL02693:4932415D10Rik APN 10 82285258 missense probably benign 0.06
IGL02867:4932415D10Rik APN 10 82283820 missense probably damaging 0.96
IGL02889:4932415D10Rik APN 10 82283820 missense probably damaging 0.96
IGL03080:4932415D10Rik APN 10 82283982 missense probably damaging 0.99
IGL03120:4932415D10Rik APN 10 82285035 missense possibly damaging 0.90
IGL03351:4932415D10Rik APN 10 82283567 utr 3 prime probably benign
FR4449:4932415D10Rik UTSW 10 82285469 frame shift probably null
FR4548:4932415D10Rik UTSW 10 82290996 small insertion probably benign
FR4737:4932415D10Rik UTSW 10 82285469 small deletion probably benign
PIT4480001:4932415D10Rik UTSW 10 82283752 missense probably benign 0.06
R0102:4932415D10Rik UTSW 10 82283556 missense probably damaging 1.00
R0312:4932415D10Rik UTSW 10 82284369 missense probably damaging 1.00
R1303:4932415D10Rik UTSW 10 82284556 missense possibly damaging 0.94
R2039:4932415D10Rik UTSW 10 82284676 missense probably damaging 1.00
R2356:4932415D10Rik UTSW 10 82283955 missense possibly damaging 0.94
R4740:4932415D10Rik UTSW 10 82283647 missense possibly damaging 0.50
R4857:4932415D10Rik UTSW 10 82283848 missense possibly damaging 0.61
R5017:4932415D10Rik UTSW 10 82296676 missense unknown
R5095:4932415D10Rik UTSW 10 82283667 missense probably damaging 1.00
R5209:4932415D10Rik UTSW 10 82283818 missense possibly damaging 0.84
R5388:4932415D10Rik UTSW 10 82283727 missense probably damaging 0.99
R5642:4932415D10Rik UTSW 10 82284483 missense probably damaging 1.00
R5646:4932415D10Rik UTSW 10 82283776 missense probably damaging 0.99
R6188:4932415D10Rik UTSW 10 82285257 missense probably damaging 0.96
R6215:4932415D10Rik UTSW 10 82291112 missense probably benign 0.07
R6252:4932415D10Rik UTSW 10 82283754 missense probably benign 0.30
R6275:4932415D10Rik UTSW 10 82285368 missense probably damaging 1.00
R6303:4932415D10Rik UTSW 10 82290368 missense possibly damaging 0.79
R6304:4932415D10Rik UTSW 10 82290368 missense possibly damaging 0.79
R6313:4932415D10Rik UTSW 10 82293636 missense probably benign 0.00
R6323:4932415D10Rik UTSW 10 82283082 missense probably benign 0.27
R6374:4932415D10Rik UTSW 10 82288897 unclassified probably benign
R6407:4932415D10Rik UTSW 10 82293811 missense probably benign 0.16
R6468:4932415D10Rik UTSW 10 82295316 missense probably benign 0.01
R6490:4932415D10Rik UTSW 10 82289304 missense possibly damaging 0.90
R6605:4932415D10Rik UTSW 10 82296037 missense probably benign 0.27
R6614:4932415D10Rik UTSW 10 82291648 missense probably benign 0.31
R6626:4932415D10Rik UTSW 10 82292833 missense probably benign 0.03
R6630:4932415D10Rik UTSW 10 82287072 missense possibly damaging 0.81
R6646:4932415D10Rik UTSW 10 82296830 missense unknown
R6723:4932415D10Rik UTSW 10 82289823 missense possibly damaging 0.50
R6751:4932415D10Rik UTSW 10 82283497 missense probably benign 0.06
R6850:4932415D10Rik UTSW 10 82293054 missense possibly damaging 0.68
R6944:4932415D10Rik UTSW 10 82296222 missense probably benign 0.03
R6957:4932415D10Rik UTSW 10 82293786 missense probably benign 0.03
R6988:4932415D10Rik UTSW 10 82291899 missense possibly damaging 0.79
R7069:4932415D10Rik UTSW 10 82289943 missense probably damaging 0.99
R7175:4932415D10Rik UTSW 10 82286749 missense probably damaging 1.00
R7201:4932415D10Rik UTSW 10 82291627 missense probably benign 0.03
R7203:4932415D10Rik UTSW 10 82293414 missense probably benign 0.00
R7205:4932415D10Rik UTSW 10 82289327 missense probably benign 0.35
R7241:4932415D10Rik UTSW 10 82287042 missense probably benign 0.01
R7283:4932415D10Rik UTSW 10 82291297 missense possibly damaging 0.90
R7305:4932415D10Rik UTSW 10 82285119 missense probably benign 0.06
R7358:4932415D10Rik UTSW 10 82292013 missense possibly damaging 0.79
R7360:4932415D10Rik UTSW 10 82296507 missense unknown
R7362:4932415D10Rik UTSW 10 82292997 missense possibly damaging 0.79
R7385:4932415D10Rik UTSW 10 82287737 missense probably benign 0.03
R7385:4932415D10Rik UTSW 10 82287895 missense probably benign 0.05
R7472:4932415D10Rik UTSW 10 82283587 missense probably benign 0.03
R7493:4932415D10Rik UTSW 10 82288964 nonsense probably null
R7493:4932415D10Rik UTSW 10 82316430 missense unknown
R7498:4932415D10Rik UTSW 10 82291279 missense probably benign 0.03
R7512:4932415D10Rik UTSW 10 82292635 missense probably benign 0.31
R7560:4932415D10Rik UTSW 10 82284615 missense probably damaging 1.00
R7591:4932415D10Rik UTSW 10 82292212 missense probably benign 0.16
R7636:4932415D10Rik UTSW 10 82295139 missense probably benign 0.01
R7640:4932415D10Rik UTSW 10 82294656 missense probably damaging 0.99
R7709:4932415D10Rik UTSW 10 82290532 missense possibly damaging 0.81
R7790:4932415D10Rik UTSW 10 82287495 missense probably benign 0.06
R7875:4932415D10Rik UTSW 10 82287622 missense possibly damaging 0.79
R7878:4932415D10Rik UTSW 10 82284022 missense probably benign 0.04
R7899:4932415D10Rik UTSW 10 82282897 missense unknown
R7905:4932415D10Rik UTSW 10 82296102 missense probably benign 0.03
R7958:4932415D10Rik UTSW 10 82287622 missense possibly damaging 0.79
R7961:4932415D10Rik UTSW 10 82284022 missense probably benign 0.04
R7982:4932415D10Rik UTSW 10 82282897 missense unknown
R7988:4932415D10Rik UTSW 10 82296102 missense probably benign 0.03
RF017:4932415D10Rik UTSW 10 82290992 small insertion probably benign
RF055:4932415D10Rik UTSW 10 82290993 small insertion probably benign
Z1176:4932415D10Rik UTSW 10 82282537 missense unknown
Z1176:4932415D10Rik UTSW 10 82289896 missense possibly damaging 0.94
Z1176:4932415D10Rik UTSW 10 82293228 missense probably benign 0.03
Z1177:4932415D10Rik UTSW 10 82285798 missense possibly damaging 0.46
Z1177:4932415D10Rik UTSW 10 82287126 missense possibly damaging 0.85
Z1177:4932415D10Rik UTSW 10 82287417 missense probably damaging 0.99
Z1177:4932415D10Rik UTSW 10 82289686 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGATTGCACATTTTGTAGCC -3'
(R):5'- GCAAACCAGTCAAGTTGAGG -3'

Sequencing Primer
(F):5'- GGATTGCACATTTTGTAGCCAAAGG -3'
(R):5'- TCAAGTTGAGGGAAATACAGACTCTG -3'
Posted On2019-06-26