Incidental Mutation 'R7284:Ano6'
ID 565906
Institutional Source Beutler Lab
Gene Symbol Ano6
Ensembl Gene ENSMUSG00000064210
Gene Name anoctamin 6
Synonyms F730003B03Rik, 2900059G15Rik, Tmem16f
MMRRC Submission 045392-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.552) question?
Stock # R7284 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 95688724-95872632 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 95846184 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 474 (I474T)
Ref Sequence ENSEMBL: ENSMUSP00000071770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071874] [ENSMUST00000227151] [ENSMUST00000227791]
AlphaFold Q6P9J9
Predicted Effect probably damaging
Transcript: ENSMUST00000071874
AA Change: I474T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071770
Gene: ENSMUSG00000064210
AA Change: I474T

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
Pfam:Anoct_dimer 63 285 4.5e-70 PFAM
Pfam:Anoctamin 288 872 3.3e-137 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227151
Predicted Effect probably damaging
Transcript: ENSMUST00000227791
AA Change: I495T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-pass transmembrane protein that belongs to the anoctamin family. This protein is an essential component for the calcium-dependent exposure of phosphatidylserine on the cell surface. The scrambling of phospholipid occurs in various biological systems, such as when blood platelets are activated, they expose phosphatidylserine to trigger the clotting system. Mutations in this gene are associated with Scott syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired platelet coagulation with increased bleeding time. Mice homozygous for a different knock out allele or gene trap exhibit decreased bone mineral deposition and skeletal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik G T 7: 12,246,605 (GRCm39) E34* probably null Het
4933421I07Rik C T 7: 42,097,404 (GRCm39) R30H probably damaging Het
AB124611 C A 9: 21,450,400 (GRCm39) Q158K probably benign Het
Abcc3 C T 11: 94,247,873 (GRCm39) A1207T probably benign Het
Abcc9 A T 6: 142,628,643 (GRCm39) L367Q probably damaging Het
Aftph T C 11: 20,676,812 (GRCm39) K266E probably benign Het
Akap9 T A 5: 4,006,246 (GRCm39) D190E probably damaging Het
Angel1 G T 12: 86,767,298 (GRCm39) D359E probably damaging Het
Atp2c1 A T 9: 105,398,008 (GRCm39) probably null Het
Best1 T C 19: 9,963,737 (GRCm39) probably null Het
Bhlha9 A G 11: 76,563,492 (GRCm39) S40G probably benign Het
Cabin1 G A 10: 75,530,668 (GRCm39) R178C Het
Ccnb1ip1 A G 14: 51,029,736 (GRCm39) Y109H probably damaging Het
Col14a1 T C 15: 55,381,715 (GRCm39) S1763P probably damaging Het
Dars1 T C 1: 128,300,004 (GRCm39) T327A probably benign Het
Dhx8 T C 11: 101,645,648 (GRCm39) Y889H probably damaging Het
Dlg4 T A 11: 69,932,908 (GRCm39) Y523* probably null Het
Dnah10 A T 5: 124,909,662 (GRCm39) D4484V probably benign Het
Dnah9 A T 11: 65,881,302 (GRCm39) M2591K probably damaging Het
Dock2 T C 11: 34,180,672 (GRCm39) E1715G probably benign Het
Dym A G 18: 75,252,242 (GRCm39) Y336C possibly damaging Het
Ezh2 A G 6: 47,521,453 (GRCm39) M439T probably benign Het
Folr1 T G 7: 101,508,677 (GRCm39) N83H possibly damaging Het
Ganab T C 19: 8,889,904 (GRCm39) L656P probably damaging Het
Gmnc T C 16: 26,779,542 (GRCm39) H161R probably benign Het
Gria4 A G 9: 4,472,017 (GRCm39) Y491H probably damaging Het
Heatr3 T A 8: 88,883,402 (GRCm39) C412S possibly damaging Het
Hmgcr A C 13: 96,789,173 (GRCm39) V716G probably damaging Het
Igsf9 A G 1: 172,324,479 (GRCm39) D799G probably damaging Het
Ikbkb T C 8: 23,158,976 (GRCm39) T501A probably benign Het
Kbtbd3 C T 9: 4,330,690 (GRCm39) R355* probably null Het
Kcna7 T A 7: 45,058,652 (GRCm39) I313N probably damaging Het
Kirrel1 A C 3: 86,990,694 (GRCm39) D709E probably benign Het
Klb T A 5: 65,540,821 (GRCm39) S971R probably benign Het
Krtap4-13 A T 11: 99,700,238 (GRCm39) C140* probably null Het
Lacc1 A T 14: 77,268,309 (GRCm39) L334Q probably damaging Het
Map6d1 T A 16: 20,059,775 (GRCm39) R97* probably null Het
Mgat5b T C 11: 116,835,746 (GRCm39) S129P probably damaging Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Myh9 G A 15: 77,671,796 (GRCm39) R432C probably damaging Het
Ncf4 A G 15: 78,144,902 (GRCm39) T236A probably benign Het
Neb T C 2: 52,148,804 (GRCm39) D2581G probably damaging Het
Nid1 T A 13: 13,663,675 (GRCm39) M778K probably benign Het
Npas2 A G 1: 39,363,548 (GRCm39) D209G probably benign Het
Nploc4 C T 11: 120,307,196 (GRCm39) V181I possibly damaging Het
Nrcam A T 12: 44,610,817 (GRCm39) I506F probably damaging Het
Or52w1 T A 7: 105,017,752 (GRCm39) M73K probably damaging Het
Or5h27 A G 16: 59,006,331 (GRCm39) *172Q probably null Het
Or6c3b T C 10: 129,527,220 (GRCm39) N230S probably benign Het
Pask T A 1: 93,248,391 (GRCm39) Q970L probably benign Het
Pfkfb4 T C 9: 108,840,308 (GRCm39) I308T possibly damaging Het
Pla2g4d A T 2: 120,114,617 (GRCm39) L38Q probably damaging Het
Pld1 A G 3: 28,185,882 (GRCm39) T1036A possibly damaging Het
Pom121l2 A G 13: 22,166,775 (GRCm39) T349A probably damaging Het
Ppp1r13b A G 12: 111,801,400 (GRCm39) I551T possibly damaging Het
Prps1l1 A G 12: 35,035,317 (GRCm39) N144S possibly damaging Het
Prss56 A G 1: 87,113,123 (GRCm39) N179S probably null Het
Prune2 T C 19: 17,097,250 (GRCm39) L918P probably damaging Het
Ptprz1 C T 6: 23,000,097 (GRCm39) T729I probably damaging Het
Relch T A 1: 105,662,308 (GRCm39) H942Q probably benign Het
Rrp7a T C 15: 83,006,071 (GRCm39) T60A probably damaging Het
Snx27 A G 3: 94,431,498 (GRCm39) Y299H probably damaging Het
Spaca3 G T 11: 80,754,847 (GRCm39) R96L possibly damaging Het
Stat1 A G 1: 52,188,081 (GRCm39) N495S probably benign Het
Tas2r130 T C 6: 131,607,270 (GRCm39) N175S probably benign Het
Tcaf2 A G 6: 42,606,472 (GRCm39) L494P probably damaging Het
Tdrd12 C A 7: 35,179,561 (GRCm39) probably null Het
Thbs1 A G 2: 117,949,837 (GRCm39) N604S probably damaging Het
Togaram1 T C 12: 65,055,454 (GRCm39) F1482L probably benign Het
Trhr2 A T 8: 123,087,114 (GRCm39) S109T probably damaging Het
Trpc3 A T 3: 36,678,562 (GRCm39) M841K probably damaging Het
Tubgcp5 C T 7: 55,473,315 (GRCm39) R798C probably benign Het
Xirp2 T A 2: 67,347,173 (GRCm39) M3138K probably benign Het
Zdhhc4 G A 5: 143,307,646 (GRCm39) T125I probably benign Het
Zfp239 T A 6: 117,848,716 (GRCm39) C151* probably null Het
Zfp473 C T 7: 44,382,627 (GRCm39) E569K not run Het
Zzef1 T A 11: 72,777,516 (GRCm39) D1782E probably damaging Het
Other mutations in Ano6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Ano6 APN 15 95,846,310 (GRCm39) missense probably damaging 1.00
IGL01308:Ano6 APN 15 95,811,542 (GRCm39) splice site probably null
IGL01490:Ano6 APN 15 95,846,291 (GRCm39) missense probably benign 0.08
IGL01663:Ano6 APN 15 95,865,495 (GRCm39) splice site probably null
IGL01783:Ano6 APN 15 95,860,143 (GRCm39) missense possibly damaging 0.94
IGL02040:Ano6 APN 15 95,853,825 (GRCm39) missense probably benign 0.00
IGL02114:Ano6 APN 15 95,841,341 (GRCm39) missense probably damaging 0.96
IGL02683:Ano6 APN 15 95,846,193 (GRCm39) missense probably damaging 1.00
IGL03297:Ano6 APN 15 95,860,158 (GRCm39) missense probably damaging 1.00
IGL03401:Ano6 APN 15 95,847,786 (GRCm39) missense probably damaging 1.00
R0730:Ano6 UTSW 15 95,818,252 (GRCm39) missense probably damaging 1.00
R1086:Ano6 UTSW 15 95,847,843 (GRCm39) splice site probably null
R1264:Ano6 UTSW 15 95,847,447 (GRCm39) missense probably damaging 1.00
R1421:Ano6 UTSW 15 95,811,266 (GRCm39) missense probably benign 0.13
R1494:Ano6 UTSW 15 95,870,388 (GRCm39) missense probably damaging 0.98
R1755:Ano6 UTSW 15 95,870,451 (GRCm39) missense possibly damaging 0.74
R1757:Ano6 UTSW 15 95,860,148 (GRCm39) missense probably damaging 1.00
R2042:Ano6 UTSW 15 95,853,904 (GRCm39) critical splice donor site probably null
R2393:Ano6 UTSW 15 95,863,906 (GRCm39) critical splice donor site probably benign
R2415:Ano6 UTSW 15 95,860,161 (GRCm39) missense probably damaging 1.00
R2483:Ano6 UTSW 15 95,863,855 (GRCm39) missense probably benign 0.00
R2879:Ano6 UTSW 15 95,841,308 (GRCm39) nonsense probably null
R3440:Ano6 UTSW 15 95,865,602 (GRCm39) missense probably damaging 1.00
R3716:Ano6 UTSW 15 95,811,260 (GRCm39) missense probably damaging 1.00
R3717:Ano6 UTSW 15 95,811,260 (GRCm39) missense probably damaging 1.00
R3718:Ano6 UTSW 15 95,811,260 (GRCm39) missense probably damaging 1.00
R3887:Ano6 UTSW 15 95,792,330 (GRCm39) missense possibly damaging 0.64
R4175:Ano6 UTSW 15 95,860,050 (GRCm39) missense probably damaging 1.00
R4214:Ano6 UTSW 15 95,863,790 (GRCm39) missense probably benign
R4591:Ano6 UTSW 15 95,841,308 (GRCm39) nonsense probably null
R5249:Ano6 UTSW 15 95,811,469 (GRCm39) missense probably benign 0.35
R5383:Ano6 UTSW 15 95,813,918 (GRCm39) missense probably benign 0.00
R5496:Ano6 UTSW 15 95,865,495 (GRCm39) splice site probably null
R5532:Ano6 UTSW 15 95,860,122 (GRCm39) missense probably damaging 1.00
R5598:Ano6 UTSW 15 95,839,228 (GRCm39) missense probably damaging 1.00
R5645:Ano6 UTSW 15 95,818,232 (GRCm39) missense probably benign 0.03
R5739:Ano6 UTSW 15 95,811,260 (GRCm39) missense probably damaging 1.00
R5794:Ano6 UTSW 15 95,792,405 (GRCm39) missense probably benign 0.00
R5864:Ano6 UTSW 15 95,818,261 (GRCm39) critical splice donor site probably null
R5936:Ano6 UTSW 15 95,870,482 (GRCm39) missense probably damaging 1.00
R5937:Ano6 UTSW 15 95,811,838 (GRCm39) missense probably damaging 0.98
R6063:Ano6 UTSW 15 95,846,298 (GRCm39) missense probably damaging 1.00
R6191:Ano6 UTSW 15 95,846,380 (GRCm39) critical splice donor site probably null
R6275:Ano6 UTSW 15 95,811,314 (GRCm39) missense probably damaging 1.00
R6349:Ano6 UTSW 15 95,863,903 (GRCm39) missense probably damaging 0.97
R6468:Ano6 UTSW 15 95,865,595 (GRCm39) missense probably benign 0.01
R6734:Ano6 UTSW 15 95,847,417 (GRCm39) missense probably damaging 0.99
R6830:Ano6 UTSW 15 95,792,342 (GRCm39) missense probably damaging 1.00
R6883:Ano6 UTSW 15 95,859,992 (GRCm39) missense probably damaging 1.00
R6892:Ano6 UTSW 15 95,865,505 (GRCm39) missense probably damaging 1.00
R7171:Ano6 UTSW 15 95,818,172 (GRCm39) missense probably damaging 1.00
R7271:Ano6 UTSW 15 95,811,781 (GRCm39) missense probably damaging 1.00
R7326:Ano6 UTSW 15 95,762,125 (GRCm39) missense possibly damaging 0.95
R7937:Ano6 UTSW 15 95,870,470 (GRCm39) missense probably damaging 1.00
R7944:Ano6 UTSW 15 95,839,190 (GRCm39) missense probably damaging 1.00
R7945:Ano6 UTSW 15 95,839,190 (GRCm39) missense probably damaging 1.00
R7954:Ano6 UTSW 15 95,863,702 (GRCm39) missense possibly damaging 0.93
R8496:Ano6 UTSW 15 95,847,807 (GRCm39) missense probably damaging 1.00
R8903:Ano6 UTSW 15 95,825,463 (GRCm39) missense probably benign 0.05
R8923:Ano6 UTSW 15 95,811,428 (GRCm39) missense probably damaging 1.00
R8980:Ano6 UTSW 15 95,865,563 (GRCm39) missense probably damaging 1.00
R9241:Ano6 UTSW 15 95,688,887 (GRCm39) missense probably benign 0.04
X0066:Ano6 UTSW 15 95,841,315 (GRCm39) missense probably damaging 0.99
Z1176:Ano6 UTSW 15 95,811,341 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGCATCCCTCTCAGGTGG -3'
(R):5'- ATGATGGCCACCTTCTCGTAG -3'

Sequencing Primer
(F):5'- CTCAGGTGGGTGCTTCCTC -3'
(R):5'- CACCTTCTCGTAGATCGTGTTGAG -3'
Posted On 2019-06-26