Incidental Mutation 'R7315:Olfr860'
ID567888
Institutional Source Beutler Lab
Gene Symbol Olfr860
Ensembl Gene ENSMUSG00000066905
Gene Nameolfactory receptor 860
SynonymsMOR146-2, GA_x6K02T2PVTD-13586614-13585661
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R7315 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location19845156-19849747 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 19845835 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 261 (S261R)
Ref Sequence ENSEMBL: ENSMUSP00000130735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086482] [ENSMUST00000211924] [ENSMUST00000212353]
Predicted Effect probably damaging
Transcript: ENSMUST00000086482
AA Change: S261R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130735
Gene: ENSMUSG00000066905
AA Change: S261R

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.5e-56 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.1e-8 PFAM
Pfam:7tm_1 41 290 9.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211924
Predicted Effect probably damaging
Transcript: ENSMUST00000212353
AA Change: S261R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A C 7: 120,294,118 I1264L probably benign Het
Abcg8 C A 17: 84,696,714 D484E probably damaging Het
Abhd13 T A 8: 9,987,970 L189H probably damaging Het
Acox2 T C 14: 8,256,139 D60G probably damaging Het
Acpp A G 9: 104,316,224 probably null Het
Agpat4 C T 17: 12,210,298 R146C probably damaging Het
Antxrl T C 14: 34,071,547 S411P unknown Het
B4galt5 A G 2: 167,301,376 V376A probably damaging Het
BB287469 A G 12: 87,819,703 E128G unknown Het
Camk1d T C 2: 5,339,230 Y198C probably damaging Het
Cd1d1 C T 3: 86,998,113 R191H possibly damaging Het
Cd93 A G 2: 148,442,541 V295A probably damaging Het
Cdc27 G A 11: 104,515,444 T615I possibly damaging Het
Cfap74 T C 4: 155,463,019 Y1221H unknown Het
Col24a1 G A 3: 145,431,870 S896N possibly damaging Het
Cst7 C A 2: 150,570,583 P22Q probably benign Het
Dnah6 C T 6: 73,084,760 A2781T probably damaging Het
Dscaml1 G A 9: 45,745,125 A1588T probably benign Het
Dsg2 A T 18: 20,579,160 I118F probably damaging Het
Eme2 G A 17: 24,894,866 R62W probably damaging Het
Epha3 A T 16: 63,552,609 D910E probably benign Het
Ext1 T C 15: 53,073,387 D654G probably damaging Het
Fam46b C T 4: 133,487,084 T422I probably damaging Het
Fnip2 A G 3: 79,506,205 probably null Het
Gon4l T A 3: 88,895,179 H1032Q probably benign Het
Ispd A G 12: 36,390,374 T94A probably benign Het
Kitl G A 10: 100,016,112 R31H unknown Het
Lcp2 G A 11: 34,069,906 probably null Het
Lrp2 T C 2: 69,491,822 H1921R probably damaging Het
Lvrn A G 18: 46,876,984 T400A probably benign Het
Mak16 G A 8: 31,164,738 R143* probably null Het
Mettl23 A G 11: 116,849,102 I159V probably benign Het
Mr1 T C 1: 155,129,290 N335D probably benign Het
Muc2 T C 7: 141,690,402 C12R probably damaging Het
Myom1 T C 17: 71,080,897 probably null Het
Nav2 A G 7: 49,548,289 N33S possibly damaging Het
Ninl A G 2: 150,950,050 V851A probably benign Het
Nmt1 A G 11: 103,060,183 N367D probably benign Het
Noc2l T G 4: 156,241,360 S354R probably damaging Het
Olfr104-ps G T 17: 37,362,660 C181F probably damaging Het
Olfr1302 T C 2: 111,780,659 V113A probably damaging Het
Olfr151 T C 9: 37,730,576 M136V probably benign Het
Olfr198 A G 16: 59,202,133 F98L probably benign Het
Olfr293 T C 7: 86,664,237 S192P probably damaging Het
Olfr70 T A 4: 43,696,961 I71F probably damaging Het
Olfr877 A T 9: 37,855,247 Y143F probably benign Het
Opn1sw A T 6: 29,379,363 I214N probably damaging Het
Papss2 T C 19: 32,639,225 V217A possibly damaging Het
Pes1 A G 11: 3,976,085 I291M probably benign Het
Pqlc2 G A 4: 139,301,870 T101M probably damaging Het
Ptprb T A 10: 116,362,379 I1660N possibly damaging Het
Rapgef1 C A 2: 29,734,492 T1030K probably damaging Het
Rassf8 A G 6: 145,815,751 M268V probably benign Het
Rbl2 A T 8: 91,076,012 T154S probably damaging Het
Rgs1 A G 1: 144,248,899 probably null Het
Rpgrip1 C T 14: 52,121,001 T188I not run Het
Rrp1b T A 17: 32,058,571 F608L probably benign Het
Sbp C T 17: 23,945,306 A154V probably benign Het
Scara3 C T 14: 65,931,440 E243K probably damaging Het
Serpinb6b A T 13: 32,972,257 D110V probably benign Het
Skiv2l T A 17: 34,841,169 D875V probably benign Het
Slc2a4 G C 11: 69,946,433 T59R probably damaging Het
Slc4a1 A G 11: 102,356,484 S462P probably damaging Het
Snx33 C T 9: 56,925,867 R306H probably damaging Het
Srf T C 17: 46,551,794 probably null Het
Steap3 A G 1: 120,227,912 V439A probably benign Het
Syt10 C T 15: 89,814,338 D268N probably damaging Het
Terf2 T C 8: 107,081,217 N242S probably benign Het
Tex15 A G 8: 33,581,516 T2364A probably benign Het
Tgfbr2 A T 9: 116,109,738 H365Q possibly damaging Het
Tnrc6c T G 11: 117,723,528 N837K probably benign Het
Trim67 T A 8: 124,794,330 S144T probably benign Het
Zc3hav1l T G 6: 38,295,147 D229A possibly damaging Het
Zmym4 A T 4: 126,882,592 V1184E probably benign Het
Other mutations in Olfr860
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Olfr860 APN 9 19846259 missense probably damaging 1.00
IGL02216:Olfr860 APN 9 19846565 missense probably damaging 0.99
IGL02269:Olfr860 APN 9 19845728 missense possibly damaging 0.85
IGL02964:Olfr860 APN 9 19846254 nonsense probably null
R0042:Olfr860 UTSW 9 19845779 missense probably benign
R1505:Olfr860 UTSW 9 19845788 missense probably benign 0.39
R1941:Olfr860 UTSW 9 19845950 missense probably damaging 0.99
R2030:Olfr860 UTSW 9 19846413 missense probably benign 0.30
R3150:Olfr860 UTSW 9 19846214 missense possibly damaging 0.80
R4597:Olfr860 UTSW 9 19845691 missense probably benign 0.01
R5004:Olfr860 UTSW 9 19846102 missense probably benign 0.00
R5006:Olfr860 UTSW 9 19846271 missense probably benign 0.33
R5350:Olfr860 UTSW 9 19846616 start codon destroyed probably null 0.97
R6163:Olfr860 UTSW 9 19845728 missense probably benign 0.45
R6368:Olfr860 UTSW 9 19846409 missense probably damaging 1.00
R7206:Olfr860 UTSW 9 19846560 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGGCACAGCAAGATACATTTAGATTC -3'
(R):5'- GTCAGTATCATTGTTGGATTCCTCC -3'

Sequencing Primer
(F):5'- ccattctcaattatgagaccc -3'
(R):5'- GTTGGATTCCTCCCTGCCTCAG -3'
Posted On2019-06-26