Incidental Mutation 'R4324:Hipk3'
ID323944
Institutional Source Beutler Lab
Gene Symbol Hipk3
Ensembl Gene ENSMUSG00000027177
Gene Namehomeodomain interacting protein kinase 3
SynonymsDYRK6, FIST3
MMRRC Submission 041095-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4324 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location104426481-104494446 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 104446571 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 388 (V388L)
Ref Sequence ENSEMBL: ENSMUSP00000106754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028600] [ENSMUST00000111124] [ENSMUST00000111125]
Predicted Effect probably damaging
Transcript: ENSMUST00000028600
AA Change: V388L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000028600
Gene: ENSMUSG00000027177
AA Change: V388L

DomainStartEndE-ValueType
S_TKc 197 525 1.58e-76 SMART
low complexity region 844 859 N/A INTRINSIC
low complexity region 887 906 N/A INTRINSIC
low complexity region 1093 1117 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111124
AA Change: V388L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106753
Gene: ENSMUSG00000027177
AA Change: V388L

DomainStartEndE-ValueType
S_TKc 197 525 1.58e-76 SMART
low complexity region 844 859 N/A INTRINSIC
low complexity region 887 906 N/A INTRINSIC
low complexity region 1093 1117 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111125
AA Change: V388L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106754
Gene: ENSMUSG00000027177
AA Change: V388L

DomainStartEndE-ValueType
S_TKc 197 525 1.58e-76 SMART
low complexity region 865 880 N/A INTRINSIC
low complexity region 908 927 N/A INTRINSIC
low complexity region 1114 1138 N/A INTRINSIC
Meta Mutation Damage Score 0.1684 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit impaired insulin secretion and glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afp A G 5: 90,507,905 D583G probably benign Het
Alg9 T G 9: 50,805,343 H22Q probably damaging Het
Aqp6 G A 15: 99,601,410 M1I probably null Het
Arhgef10 T A 8: 14,940,335 I270N possibly damaging Het
Asb13 G T 13: 3,645,012 R160L possibly damaging Het
Atg10 T A 13: 91,040,966 D75V probably damaging Het
Atxn7l2 A T 3: 108,205,832 D218E probably damaging Het
Ccdc191 A G 16: 43,947,509 E624G probably damaging Het
Cdan1 T C 2: 120,724,979 I760M probably damaging Het
Cdk14 T A 5: 5,036,532 K263* probably null Het
Cdk5rap2 A T 4: 70,353,614 I287N probably damaging Het
Cdkn2aip A T 8: 47,712,173 S168R probably benign Het
Dnah17 C T 11: 118,094,213 V1555M probably benign Het
Dsel T C 1: 111,861,393 T471A probably damaging Het
Dzank1 T C 2: 144,488,698 E478G possibly damaging Het
Enc1 T C 13: 97,245,897 F305S probably benign Het
Epn1 T A 7: 5,097,211 M441K probably benign Het
Fbxw24 C T 9: 109,604,945 probably null Het
Gad1 G A 2: 70,589,830 D353N probably damaging Het
Ggcx A G 6: 72,428,820 S545G probably benign Het
H2-K1 C T 17: 34,000,040 V30M possibly damaging Het
Krt82 T A 15: 101,541,747 M505L probably benign Het
Man2a1 A G 17: 64,666,793 I355V probably benign Het
Olfr473 C T 7: 107,933,693 P58S probably damaging Het
Pcbp3 G A 10: 76,763,343 R109* probably null Het
Pcgf1 T C 6: 83,079,957 probably null Het
Plekhm2 A T 4: 141,631,857 V533E possibly damaging Het
Prss3 T G 6: 41,373,845 D237A probably benign Het
Rnf125 G A 18: 20,977,760 R25K probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Shc4 T A 2: 125,678,750 M260L probably benign Het
Spag6l T C 16: 16,787,235 Y151C probably benign Het
Stac3 C T 10: 127,503,249 P76S probably damaging Het
Trpc7 T C 13: 56,887,356 I255V probably damaging Het
Ttn T C 2: 76,908,579 E3872G probably benign Het
Uqcrfs1 A G 13: 30,541,158 V133A probably benign Het
Vmn2r52 T A 7: 10,171,013 T300S possibly damaging Het
Wipi1 A T 11: 109,603,836 I57N possibly damaging Het
Other mutations in Hipk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00717:Hipk3 APN 2 104430231 missense possibly damaging 0.52
IGL00937:Hipk3 APN 2 104433172 missense possibly damaging 0.82
IGL01719:Hipk3 APN 2 104437089 missense possibly damaging 0.78
IGL01802:Hipk3 APN 2 104471853 splice site probably benign
IGL01932:Hipk3 APN 2 104470981 missense probably damaging 1.00
IGL02089:Hipk3 APN 2 104431379 missense probably damaging 1.00
IGL02522:Hipk3 APN 2 104471331 missense probably damaging 1.00
IGL02525:Hipk3 APN 2 104471412 missense probably damaging 1.00
IGL02959:Hipk3 APN 2 104471259 missense probably damaging 1.00
IGL02986:Hipk3 APN 2 104433741 missense probably damaging 1.00
R0136:Hipk3 UTSW 2 104439293 missense probably benign 0.02
R0277:Hipk3 UTSW 2 104441248 missense probably damaging 1.00
R0308:Hipk3 UTSW 2 104433207 missense probably damaging 0.99
R0367:Hipk3 UTSW 2 104431249 nonsense probably null
R0597:Hipk3 UTSW 2 104433637 missense possibly damaging 0.94
R1079:Hipk3 UTSW 2 104471698 missense probably benign 0.00
R1171:Hipk3 UTSW 2 104471676 missense probably benign 0.02
R1244:Hipk3 UTSW 2 104433256 missense probably damaging 1.00
R1509:Hipk3 UTSW 2 104441262 missense probably benign 0.01
R1616:Hipk3 UTSW 2 104433745 nonsense probably null
R1893:Hipk3 UTSW 2 104433256 missense probably damaging 1.00
R1938:Hipk3 UTSW 2 104430188 missense possibly damaging 0.89
R1969:Hipk3 UTSW 2 104433841 missense probably damaging 1.00
R1975:Hipk3 UTSW 2 104471173 missense probably benign 0.00
R1985:Hipk3 UTSW 2 104434435 missense probably benign 0.16
R2105:Hipk3 UTSW 2 104439392 missense probably damaging 0.97
R2422:Hipk3 UTSW 2 104471485 missense probably benign 0.01
R3028:Hipk3 UTSW 2 104433790 missense probably benign
R3747:Hipk3 UTSW 2 104441283 nonsense probably null
R3923:Hipk3 UTSW 2 104470762 missense probably damaging 1.00
R4320:Hipk3 UTSW 2 104446571 missense probably damaging 1.00
R4321:Hipk3 UTSW 2 104446571 missense probably damaging 1.00
R4322:Hipk3 UTSW 2 104446571 missense probably damaging 1.00
R4323:Hipk3 UTSW 2 104446571 missense probably damaging 1.00
R4595:Hipk3 UTSW 2 104441277 missense probably benign 0.01
R4604:Hipk3 UTSW 2 104439329 missense probably damaging 1.00
R4657:Hipk3 UTSW 2 104433759 missense probably benign 0.00
R5193:Hipk3 UTSW 2 104430000 missense possibly damaging 0.94
R5769:Hipk3 UTSW 2 104434953 missense possibly damaging 0.69
R5843:Hipk3 UTSW 2 104440224 missense possibly damaging 0.65
R5906:Hipk3 UTSW 2 104471808 missense probably damaging 1.00
R5976:Hipk3 UTSW 2 104471184 missense probably damaging 1.00
R5991:Hipk3 UTSW 2 104437983 missense probably damaging 1.00
R6214:Hipk3 UTSW 2 104433741 missense probably damaging 1.00
R6215:Hipk3 UTSW 2 104433741 missense probably damaging 1.00
R6285:Hipk3 UTSW 2 104471425 missense probably damaging 1.00
R6523:Hipk3 UTSW 2 104439408 missense possibly damaging 0.50
R6713:Hipk3 UTSW 2 104446571 missense probably damaging 1.00
R7381:Hipk3 UTSW 2 104439351 missense probably damaging 0.99
R7517:Hipk3 UTSW 2 104434714 missense probably benign 0.00
X0021:Hipk3 UTSW 2 104441366 critical splice acceptor site probably null
Z1088:Hipk3 UTSW 2 104434629 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTTGACATTCATGGAGATTTTC -3'
(R):5'- TGACCGAGGGTTAGGATCG -3'

Sequencing Primer
(F):5'- CACATTTTGTGTATGGAGAATCATGC -3'
(R):5'- GTTTGACAAGTTCTCAGCGAC -3'
Posted On2015-06-24