Incidental Mutation 'R7537:Snx13'
ID583676
Institutional Source Beutler Lab
Gene Symbol Snx13
Ensembl Gene ENSMUSG00000020590
Gene Namesorting nexin 13
SynonymsRGS-PX1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7537 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location35047186-35147479 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35085982 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 92 (D92G)
Ref Sequence ENSEMBL: ENSMUSP00000038430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048519] [ENSMUST00000163677] [ENSMUST00000221272]
Predicted Effect probably damaging
Transcript: ENSMUST00000048519
AA Change: D92G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038430
Gene: ENSMUSG00000020590
AA Change: D92G

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 34 51 N/A INTRINSIC
PXA 98 285 9.09e-102 SMART
coiled coil region 293 320 N/A INTRINSIC
RGS 374 514 4.63e-32 SMART
low complexity region 546 562 N/A INTRINSIC
PX 564 677 2.88e-31 SMART
Pfam:Nexin_C 793 903 1.9e-29 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000130182
Gene: ENSMUSG00000020590
AA Change: D92G

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 34 51 N/A INTRINSIC
PXA 97 284 9.09e-102 SMART
coiled coil region 292 319 N/A INTRINSIC
RGS 373 513 4.63e-32 SMART
low complexity region 545 561 N/A INTRINSIC
PX 563 676 2.88e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221272
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a PHOX domain- and RGS domain-containing protein that belongs to the sorting nexin (SNX) family and the regulator of G protein signaling (RGS) family. The PHOX domain is a phosphoinositide binding domain, and the SNX family members are involved in intracellular trafficking. The RGS family members are regulatory molecules that act as GTPase activating proteins for G alpha subunits of heterotrimeric G proteins. The RGS domain of this protein interacts with G alpha(s), accelerates its GTP hydrolysis, and attenuates G alpha(s)-mediated signaling. Overexpression of this protein delayes lysosomal degradation of the epidermal growth factor receptor. Because of its bifunctional role, this protein may link heterotrimeric G protein signaling and vesicular trafficking. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are growth retarded and die at midgestation with defects in neural tube closure, vasculogenesis and placental development. Mutant visceral yolk sac endoderm cells exhibit altered endocytic compartments, abundant autophagic vacuoles and mislocalization of endocytic markers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,173,988 L2229P possibly damaging Het
Acaca T A 11: 84,260,634 M786K probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adap1 T G 5: 139,293,173 E117D possibly damaging Het
Ap5z1 T C 5: 142,477,298 S746P probably benign Het
Appl2 A G 10: 83,617,428 I208T possibly damaging Het
Astn1 A G 1: 158,505,386 E346G possibly damaging Het
Astn1 G A 1: 158,667,638 probably null Het
Atp23 T A 10: 126,868,725 I180L unknown Het
Bean1 CT C 8: 104,182,032 probably null Het
Cdh23 A T 10: 60,384,945 I1340N probably benign Het
Cdh8 G A 8: 99,098,885 Q493* probably null Het
Ces1g T C 8: 93,319,827 I357V probably benign Het
Ddx46 A G 13: 55,650,478 D226G probably damaging Het
Eea1 C T 10: 95,994,905 Q143* probably null Het
Erlin2 G T 8: 27,031,772 probably null Het
Fat3 T A 9: 15,938,319 D3929V probably damaging Het
Flt3 T C 5: 147,334,437 D898G probably damaging Het
Gm16519 A G 17: 70,929,356 N100S probably benign Het
Gnl1 A G 17: 35,988,536 H533R probably damaging Het
Gphn A G 12: 78,504,680 T301A possibly damaging Het
Herc2 C T 7: 56,219,779 R4295* probably null Het
Insm2 T C 12: 55,599,518 S16P possibly damaging Het
Jak2 C T 19: 29,298,637 T778I probably benign Het
Lrriq3 A G 3: 155,101,097 T128A probably damaging Het
Lst1 A G 17: 35,186,944 probably null Het
Magi1 G T 6: 93,708,110 Y762* probably null Het
Man2b1 T A 8: 85,090,965 C358* probably null Het
Mga T C 2: 119,935,551 V1432A probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Morc2a C T 11: 3,683,566 Q587* probably null Het
Mrc2 T C 11: 105,292,797 I4T probably benign Het
Muc16 C A 9: 18,638,135 V5621F probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myo3b A G 2: 70,217,169 R340G probably benign Het
Nipal3 T C 4: 135,490,937 Y34C probably damaging Het
Nktr T A 9: 121,749,279 D804E unknown Het
Nlrp4b A G 7: 10,714,889 M340V probably benign Het
Olfr1039 A G 2: 86,131,264 V133A probably benign Het
Olfr385 T A 11: 73,589,268 T157S probably benign Het
Olfr680-ps1 A T 7: 105,092,771 M16K probably benign Het
Olfr701 G A 7: 106,818,374 C97Y probably damaging Het
Pard3 T A 8: 127,610,582 N1271K probably damaging Het
Pcdhb11 A T 18: 37,421,619 M1L possibly damaging Het
Pclo T C 5: 14,682,104 V3540A unknown Het
Pemt A G 11: 59,976,844 F154S probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Rnpc3 G T 3: 113,613,832 T376K probably benign Het
Rpe65 A G 3: 159,604,609 Y143C probably damaging Het
Sbk2 T C 7: 4,963,149 E12G probably benign Het
Slc2a5 T C 4: 150,129,069 I106T possibly damaging Het
Sorl1 C T 9: 41,980,688 V1889I probably benign Het
Spag17 A T 3: 99,939,247 N29I possibly damaging Het
Speg T C 1: 75,401,464 V878A probably damaging Het
Timp4 A G 6: 115,250,460 S53P probably damaging Het
Tssk1 G T 16: 17,895,084 E244D probably benign Het
Usp29 A C 7: 6,961,220 T21P possibly damaging Het
Vmn2r85 A T 10: 130,422,866 V440E probably benign Het
Wdr59 T C 8: 111,490,369 D270G Het
Zbbx G A 3: 75,085,519 P223S probably damaging Het
Zfp936 T A 7: 43,189,815 C235* probably null Het
Zranb3 A T 1: 128,032,847 probably null Het
Other mutations in Snx13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Snx13 APN 12 35098280 missense probably damaging 1.00
IGL01143:Snx13 APN 12 35132160 missense probably damaging 0.96
IGL01446:Snx13 APN 12 35124480 nonsense probably null
IGL01519:Snx13 APN 12 35138472 unclassified probably benign
IGL01902:Snx13 APN 12 35133307 critical splice acceptor site probably null
IGL01903:Snx13 APN 12 35085969 missense probably benign 0.06
IGL02146:Snx13 APN 12 35101079 missense probably benign 0.00
IGL02175:Snx13 APN 12 35132062 missense possibly damaging 0.83
IGL02197:Snx13 APN 12 35106801 missense probably damaging 1.00
IGL02200:Snx13 APN 12 35086885 missense probably damaging 1.00
IGL02476:Snx13 APN 12 35086941 missense probably damaging 1.00
IGL03171:Snx13 APN 12 35100540 missense probably benign 0.28
jiaozhi UTSW 12 35144220 missense probably damaging 0.98
resistance UTSW 12 35112445 missense probably damaging 1.00
IGL02835:Snx13 UTSW 12 35132127 missense possibly damaging 0.48
P0042:Snx13 UTSW 12 35107542 missense probably damaging 1.00
R0047:Snx13 UTSW 12 35101124 splice site probably benign
R0047:Snx13 UTSW 12 35101124 splice site probably benign
R0344:Snx13 UTSW 12 35086900 nonsense probably null
R1240:Snx13 UTSW 12 35091406 missense probably damaging 0.99
R1335:Snx13 UTSW 12 35132124 missense probably benign 0.16
R1451:Snx13 UTSW 12 35078984 missense probably benign 0.00
R1617:Snx13 UTSW 12 35086896 missense probably damaging 0.99
R2065:Snx13 UTSW 12 35138066 missense possibly damaging 0.91
R2111:Snx13 UTSW 12 35138085 missense probably damaging 1.00
R2385:Snx13 UTSW 12 35119793 missense probably benign 0.36
R2437:Snx13 UTSW 12 35082927 missense probably benign 0.14
R2511:Snx13 UTSW 12 35138081 missense probably benign 0.13
R2860:Snx13 UTSW 12 35138117 missense probably benign 0.45
R2861:Snx13 UTSW 12 35138117 missense probably benign 0.45
R2862:Snx13 UTSW 12 35138117 missense probably benign 0.45
R2992:Snx13 UTSW 12 35105191 missense probably damaging 1.00
R3938:Snx13 UTSW 12 35144097 missense probably benign 0.10
R4304:Snx13 UTSW 12 35122942 missense probably benign 0.10
R4532:Snx13 UTSW 12 35144220 missense probably damaging 0.98
R4692:Snx13 UTSW 12 35086918 missense possibly damaging 0.82
R4783:Snx13 UTSW 12 35098286 missense probably damaging 1.00
R4914:Snx13 UTSW 12 35132033 missense possibly damaging 0.84
R5309:Snx13 UTSW 12 35144325 nonsense probably null
R5425:Snx13 UTSW 12 35100644 nonsense probably null
R5476:Snx13 UTSW 12 35106820 splice site probably null
R5533:Snx13 UTSW 12 35123026 critical splice donor site probably null
R5564:Snx13 UTSW 12 35124472 missense possibly damaging 0.61
R5572:Snx13 UTSW 12 35103120 missense probably damaging 1.00
R5635:Snx13 UTSW 12 35140171 missense probably benign 0.00
R6018:Snx13 UTSW 12 35047319 start gained probably benign
R6612:Snx13 UTSW 12 35106759 missense probably benign 0.19
R6618:Snx13 UTSW 12 35112445 missense probably damaging 1.00
R6737:Snx13 UTSW 12 35140186 missense probably damaging 0.98
R6964:Snx13 UTSW 12 35119789 missense possibly damaging 0.81
R7186:Snx13 UTSW 12 35092913 missense probably damaging 0.99
R7372:Snx13 UTSW 12 35078951 missense probably benign 0.00
R7429:Snx13 UTSW 12 35133358 missense possibly damaging 0.89
R7430:Snx13 UTSW 12 35133358 missense possibly damaging 0.89
R7567:Snx13 UTSW 12 35086914 missense probably damaging 1.00
R7582:Snx13 UTSW 12 35124535 nonsense probably null
R7767:Snx13 UTSW 12 35107484 missense probably damaging 1.00
R7771:Snx13 UTSW 12 35124528 missense probably benign
R7838:Snx13 UTSW 12 35105175 missense probably benign 0.26
R7901:Snx13 UTSW 12 35100625 missense probably benign 0.02
R8029:Snx13 UTSW 12 35119886 missense probably damaging 1.00
R8418:Snx13 UTSW 12 35098234 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCCCCGAGTAATCAAATTTG -3'
(R):5'- CCAATGGGATTGTTCAATAAGACTGAC -3'

Sequencing Primer
(F):5'- TGGAGAGATCTGAAATCAAG -3'
(R):5'- GAGGTGTACCTTAGCATTTG -3'
Posted On2019-10-17