Incidental Mutation 'R7559:Knl1'
ID584926
Institutional Source Beutler Lab
Gene Symbol Knl1
Ensembl Gene ENSMUSG00000027326
Gene Namekinetochore scaffold 1
Synonyms2310043D08Rik, 5730505K17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7559 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location119047119-119105501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119094006 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1840 (E1840G)
Ref Sequence ENSEMBL: ENSMUSP00000028802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028802] [ENSMUST00000099542]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028802
AA Change: E1840G

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028802
Gene: ENSMUSG00000027326
AA Change: E1840G

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
internal_repeat_1 98 304 1.57e-6 PROSPERO
low complexity region 426 433 N/A INTRINSIC
internal_repeat_1 610 824 1.57e-6 PROSPERO
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
low complexity region 1621 1644 N/A INTRINSIC
coiled coil region 1724 1755 N/A INTRINSIC
low complexity region 1836 1850 N/A INTRINSIC
low complexity region 1864 1878 N/A INTRINSIC
PDB:4NF9|B 1899 2119 1e-115 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000099542
AA Change: E1840G

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097140
Gene: ENSMUSG00000027326
AA Change: E1840G

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
internal_repeat_1 98 304 1.57e-6 PROSPERO
low complexity region 426 433 N/A INTRINSIC
internal_repeat_1 610 824 1.57e-6 PROSPERO
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
low complexity region 1621 1644 N/A INTRINSIC
coiled coil region 1724 1755 N/A INTRINSIC
low complexity region 1836 1850 N/A INTRINSIC
low complexity region 1864 1878 N/A INTRINSIC
PDB:4NF9|B 1899 2119 1e-115 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the multiprotein assembly that is required for creation of kinetochore-microtubule attachments and chromosome segregation. The encoded protein functions as a scaffold for proteins that influence the spindle assembly checkpoint during the eukaryotic cell cycle and it interacts with at least five different kinetochore proteins and two checkpoint kinases. In adults, this gene is predominantly expressed in normal testes, various cancer cell lines and primary tumors from other tissues and is ubiquitously expressed in fetal tissues. This gene was originally identified as a fusion partner with the mixed-lineage leukemia (MLL) gene in t(11;15)(q23;q14). Mutations in this gene cause autosomal recessive primary microcephaly-4 (MCPH4). Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. Mice homozygous for an ENU-induced allele exhibit possible embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adap1 C A 5: 139,279,540 R206L probably damaging Het
Adcy3 A G 12: 4,198,440 K501E probably benign Het
Agl T C 3: 116,752,115 D679G Het
Ankrd10 A T 8: 11,612,548 V395D probably damaging Het
Ano5 A G 7: 51,574,888 I531V probably damaging Het
Apol9a T A 15: 77,404,561 H202L possibly damaging Het
Atp6v1c2 A C 12: 17,301,214 I105M probably benign Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Coro1b T C 19: 4,150,221 probably null Het
D930020B18Rik A G 10: 121,656,226 probably benign Het
Dcst2 T C 3: 89,368,714 F384S possibly damaging Het
Ddx39 T A 8: 83,720,966 F147I possibly damaging Het
Drosha A G 15: 12,842,422 E393G probably damaging Het
Etfdh T C 3: 79,623,579 Y45C probably damaging Het
Fam20c G T 5: 138,793,199 E287D possibly damaging Het
Flnc T A 6: 29,459,010 D2463E probably damaging Het
Flt4 A T 11: 49,644,371 I1209F possibly damaging Het
Foxp1 T C 6: 98,945,560 D437G unknown Het
Fras1 T C 5: 96,740,854 V2753A possibly damaging Het
Ftsj3 T C 11: 106,252,987 D277G possibly damaging Het
Gad1 T C 2: 70,563,912 probably null Het
Gal3st2c A G 1: 94,009,353 Y340C probably damaging Het
Gbp9 A G 5: 105,085,109 F226L probably damaging Het
Gm11992 C T 11: 9,052,747 P37S possibly damaging Het
Gm19668 G T 10: 77,798,738 C132* probably null Het
Hdac3 A T 18: 37,945,516 F139I possibly damaging Het
Hectd4 A G 5: 121,315,510 probably null Het
Helz T A 11: 107,600,278 S162T possibly damaging Het
Hspb6 C A 7: 30,554,287 S75Y probably damaging Het
Il17rb T A 14: 29,997,043 I361F probably damaging Het
Iqsec3 A T 6: 121,387,780 V850D probably damaging Het
Lamc3 A G 2: 31,922,368 K939R probably benign Het
Lmo7 C T 14: 101,887,226 R496* probably null Het
Lsm14a A T 7: 34,353,401 C374* probably null Het
Luc7l T C 17: 26,255,115 L49P probably damaging Het
Mdga2 A C 12: 66,473,229 C988G probably damaging Het
Mtf1 T C 4: 124,820,206 V136A probably damaging Het
Myo7b T A 18: 31,983,360 I1016F probably benign Het
Nadsyn1 C A 7: 143,808,067 A306S probably benign Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nr4a1 T C 15: 101,270,899 V272A probably damaging Het
Olfr504 C T 7: 108,565,556 A80T probably damaging Het
Olfr538 T A 7: 140,574,443 C97S probably damaging Het
Olfr654 C A 7: 104,587,880 H25Q probably damaging Het
Opcml A T 9: 28,903,324 T291S probably benign Het
Osbp2 C G 11: 3,712,493 K196N probably damaging Het
Otoa T C 7: 121,143,926 V792A probably damaging Het
Pcmtd1 A G 1: 7,169,542 D245G probably damaging Het
Pcnx T C 12: 81,993,122 V1428A unknown Het
Pik3r4 A G 9: 105,678,153 H1103R probably benign Het
Pjvk C T 2: 76,655,810 H185Y probably benign Het
Pkd1l3 T C 8: 109,624,440 V639A probably benign Het
Pklr T C 3: 89,143,058 S405P probably damaging Het
Pla2g12a T A 3: 129,878,920 Y68N probably damaging Het
Proz A G 8: 13,063,455 H92R probably benign Het
Sec23ip G T 7: 128,777,350 V844F possibly damaging Het
Sema3f A G 9: 107,684,578 V520A possibly damaging Het
Serpinb12 A G 1: 106,953,723 I197V probably damaging Het
Sim2 A T 16: 94,109,359 I207F possibly damaging Het
Slc15a2 C T 16: 36,751,897 V702I probably benign Het
Slc35f4 T C 14: 49,304,275 I341V probably benign Het
Spam1 A G 6: 24,800,453 Y397C probably damaging Het
Spire1 A T 18: 67,501,117 M417K probably benign Het
Srcap T C 7: 127,530,550 S515P unknown Het
Tfrc T A 16: 32,621,417 probably null Het
Topors A G 4: 40,261,401 S628P unknown Het
Trim71 T C 9: 114,513,042 Y724C probably damaging Het
Ttn C T 2: 76,792,855 V15413I probably damaging Het
Vmn1r21 A T 6: 57,844,242 N72K probably damaging Het
Vmn2r80 A T 10: 79,194,625 M762L probably benign Het
Wdr62 A G 7: 30,270,773 I203T probably damaging Het
Other mutations in Knl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Knl1 APN 2 119064083 missense probably damaging 0.96
IGL00582:Knl1 APN 2 119102499 missense probably benign 0.19
IGL00666:Knl1 APN 2 119070464 missense probably damaging 0.96
IGL01062:Knl1 APN 2 119076980 missense probably benign 0.33
IGL01395:Knl1 APN 2 119071566 missense probably damaging 0.96
IGL01604:Knl1 APN 2 119070001 missense probably damaging 1.00
IGL01996:Knl1 APN 2 119104061 missense probably damaging 1.00
IGL02086:Knl1 APN 2 119100774 missense probably benign 0.40
IGL02105:Knl1 APN 2 119071808 missense probably benign
IGL02106:Knl1 APN 2 119072008 missense possibly damaging 0.89
IGL02201:Knl1 APN 2 119069152 missense probably benign 0.01
IGL02252:Knl1 APN 2 119072540 missense probably damaging 1.00
IGL02414:Knl1 APN 2 119070323 missense possibly damaging 0.83
IGL02655:Knl1 APN 2 119070992 missense possibly damaging 0.62
IGL02682:Knl1 APN 2 119077969 missense possibly damaging 0.86
IGL02710:Knl1 APN 2 119070930 missense probably damaging 0.99
IGL02877:Knl1 APN 2 119088831 missense probably benign 0.08
IGL03100:Knl1 APN 2 119100770 missense probably damaging 0.99
IGL03210:Knl1 APN 2 119070617 missense probably benign 0.02
IGL03138:Knl1 UTSW 2 119072359 missense probably damaging 0.96
R0023:Knl1 UTSW 2 119102549 missense possibly damaging 0.73
R0064:Knl1 UTSW 2 119076243 missense probably benign 0.00
R0064:Knl1 UTSW 2 119076243 missense probably benign 0.00
R0078:Knl1 UTSW 2 119069892 missense probably benign 0.16
R0178:Knl1 UTSW 2 119058405 splice site probably benign
R0295:Knl1 UTSW 2 119088839 missense probably damaging 1.00
R0433:Knl1 UTSW 2 119104061 missense probably damaging 0.96
R0453:Knl1 UTSW 2 119068388 missense probably damaging 1.00
R0569:Knl1 UTSW 2 119097435 missense possibly damaging 0.95
R0827:Knl1 UTSW 2 119088901 splice site probably benign
R0920:Knl1 UTSW 2 119069828 missense probably benign 0.00
R1120:Knl1 UTSW 2 119062375 missense probably damaging 0.99
R1155:Knl1 UTSW 2 119071154 missense possibly damaging 0.90
R1204:Knl1 UTSW 2 119071189 missense probably benign 0.00
R1241:Knl1 UTSW 2 119072573 missense probably benign 0.03
R1387:Knl1 UTSW 2 119070730 missense possibly damaging 0.93
R1448:Knl1 UTSW 2 119068307 missense probably damaging 1.00
R1469:Knl1 UTSW 2 119071346 missense possibly damaging 0.73
R1469:Knl1 UTSW 2 119071346 missense possibly damaging 0.73
R1719:Knl1 UTSW 2 119071738 missense probably benign 0.01
R1721:Knl1 UTSW 2 119076334 missense probably damaging 1.00
R2128:Knl1 UTSW 2 119071819 missense possibly damaging 0.79
R2170:Knl1 UTSW 2 119087594 critical splice donor site probably null
R2227:Knl1 UTSW 2 119072000 missense probably damaging 0.97
R2246:Knl1 UTSW 2 119072227 missense probably damaging 1.00
R2275:Knl1 UTSW 2 119072281 missense probably damaging 0.99
R2508:Knl1 UTSW 2 119058368 nonsense probably null
R3115:Knl1 UTSW 2 119070391 missense possibly damaging 0.53
R3122:Knl1 UTSW 2 119068944 missense probably benign 0.32
R3431:Knl1 UTSW 2 119062362 missense probably damaging 1.00
R3755:Knl1 UTSW 2 119102579 missense probably damaging 1.00
R4461:Knl1 UTSW 2 119059599 missense probably benign 0.00
R4600:Knl1 UTSW 2 119070544 missense possibly damaging 0.90
R4713:Knl1 UTSW 2 119069137 nonsense probably null
R4758:Knl1 UTSW 2 119071732 frame shift probably null
R4762:Knl1 UTSW 2 119071936 missense probably benign 0.01
R4869:Knl1 UTSW 2 119072351 missense possibly damaging 0.73
R4870:Knl1 UTSW 2 119081513 missense probably benign 0.22
R4935:Knl1 UTSW 2 119068957 missense possibly damaging 0.50
R5167:Knl1 UTSW 2 119070031 missense probably damaging 1.00
R5184:Knl1 UTSW 2 119069176 missense probably damaging 1.00
R5293:Knl1 UTSW 2 119069695 missense probably damaging 0.99
R5326:Knl1 UTSW 2 119068348 missense possibly damaging 0.66
R5331:Knl1 UTSW 2 119070255 missense possibly damaging 0.92
R5353:Knl1 UTSW 2 119070983 missense probably benign 0.01
R5493:Knl1 UTSW 2 119068730 missense probably damaging 0.98
R5542:Knl1 UTSW 2 119068348 missense possibly damaging 0.66
R5632:Knl1 UTSW 2 119070352 missense probably damaging 1.00
R5650:Knl1 UTSW 2 119081550 nonsense probably null
R5854:Knl1 UTSW 2 119070403 missense probably benign 0.02
R5979:Knl1 UTSW 2 119069360 missense possibly damaging 0.83
R6086:Knl1 UTSW 2 119094068 missense probably damaging 1.00
R6283:Knl1 UTSW 2 119070286 missense probably damaging 1.00
R6285:Knl1 UTSW 2 119071941 missense probably damaging 1.00
R6313:Knl1 UTSW 2 119069318 missense probably damaging 1.00
R6419:Knl1 UTSW 2 119069003 missense probably benign 0.02
R6608:Knl1 UTSW 2 119086612 missense probably damaging 0.99
R6881:Knl1 UTSW 2 119095184 missense possibly damaging 0.67
R7161:Knl1 UTSW 2 119070785 missense possibly damaging 0.79
R7206:Knl1 UTSW 2 119069299 missense probably benign 0.35
R7270:Knl1 UTSW 2 119102522 missense possibly damaging 0.53
R7276:Knl1 UTSW 2 119071686 missense probably damaging 0.98
R7358:Knl1 UTSW 2 119070559 missense possibly damaging 0.92
R7402:Knl1 UTSW 2 119095226 nonsense probably null
R7408:Knl1 UTSW 2 119070592 missense possibly damaging 0.54
R7475:Knl1 UTSW 2 119087546 missense probably damaging 1.00
R7516:Knl1 UTSW 2 119070698 missense probably damaging 0.99
R7524:Knl1 UTSW 2 119065979 missense probably damaging 1.00
R7607:Knl1 UTSW 2 119095133 missense possibly damaging 0.93
R7745:Knl1 UTSW 2 119071556 missense probably benign 0.13
R7847:Knl1 UTSW 2 119070976 missense probably benign 0.02
R8423:Knl1 UTSW 2 119070032 missense probably damaging 1.00
R8725:Knl1 UTSW 2 119069043 missense probably benign 0.34
R8727:Knl1 UTSW 2 119069043 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- CACTGTCATTAGCTCAGAGTTCAC -3'
(R):5'- GTTAGCTGACCTCTGAAGCTC -3'

Sequencing Primer
(F):5'- AGCTCAGAGTTCACTTATATGATACC -3'
(R):5'- CACCAGGAGAAACTTGAAACATAG -3'
Posted On2019-10-17