Mutagenetix > Incidental Mutation

Incidental Mutation 'R8423:Knl1'

653288

Institutional Source

Beutler Lab

Gene Symbol

Knl1

Ensembl Gene

ENSMUSG00000027326

Gene Name

kinetochore scaffold 1

Synonyms

Casc5, 2310043D08Rik, 5730505K17Rik

MMRRC Submission

067899-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8423 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

118877600-118935982 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 118900513 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Serine at position 738 (I738S)

Ref Sequence

ENSEMBL: ENSMUSP00000028799 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028799] [ENSMUST00000028802] [ENSMUST00000099542] [ENSMUST00000152380] [ENSMUST00000153300]

AlphaFold

Q66JQ7

Predicted Effect

probably damaging
Transcript: ENSMUST00000028799
AA Change: I738S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000028799
Gene: ENSMUSG00000027326
AA Change: I738S

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC
PDB:4A1G\|H	126	175	1e-13	PDB
low complexity region	426	433	N/A	INTRINSIC
low complexity region	883	894	N/A	INTRINSIC
low complexity region	1148	1159	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000028802
AA Change: I738S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000028802
Gene: ENSMUSG00000027326
AA Change: I738S

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC
internal_repeat_1	98	304	1.57e-6	PROSPERO
low complexity region	426	433	N/A	INTRINSIC
internal_repeat_1	610	824	1.57e-6	PROSPERO
low complexity region	883	894	N/A	INTRINSIC
low complexity region	1148	1159	N/A	INTRINSIC
low complexity region	1621	1644	N/A	INTRINSIC
coiled coil region	1724	1755	N/A	INTRINSIC
low complexity region	1836	1850	N/A	INTRINSIC
low complexity region	1864	1878	N/A	INTRINSIC
PDB:4NF9\|B	1899	2119	1e-115	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000099542
AA Change: I738S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000097140
Gene: ENSMUSG00000027326
AA Change: I738S

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC
internal_repeat_1	98	304	1.57e-6	PROSPERO
low complexity region	426	433	N/A	INTRINSIC
internal_repeat_1	610	824	1.57e-6	PROSPERO
low complexity region	883	894	N/A	INTRINSIC
low complexity region	1148	1159	N/A	INTRINSIC
low complexity region	1621	1644	N/A	INTRINSIC
coiled coil region	1724	1755	N/A	INTRINSIC
low complexity region	1836	1850	N/A	INTRINSIC
low complexity region	1864	1878	N/A	INTRINSIC
PDB:4NF9\|B	1899	2119	1e-115	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000152380

SMART Domains

Protein: ENSMUSP00000118646
Gene: ENSMUSG00000027326

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC
PDB:4A1G\|H	126	175	3e-14	PDB
low complexity region	426	433	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000153300

SMART Domains

Protein: ENSMUSP00000120905
Gene: ENSMUSG00000027326

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

98% (46/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the multiprotein assembly that is required for creation of kinetochore-microtubule attachments and chromosome segregation. The encoded protein functions as a scaffold for proteins that influence the spindle assembly checkpoint during the eukaryotic cell cycle and it interacts with at least five different kinetochore proteins and two checkpoint kinases. In adults, this gene is predominantly expressed in normal testes, various cancer cell lines and primary tumors from other tissues and is ubiquitously expressed in fetal tissues. This gene was originally identified as a fusion partner with the mixed-lineage leukemia (MLL) gene in t(11;15)(q23;q14). Mutations in this gene cause autosomal recessive primary microcephaly-4 (MCPH4). Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. Mice homozygous for an ENU-induced allele exhibit possible embryonic lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam6b	A	G	12: 113,454,530 (GRCm39)	D449G	possibly damaging	Het
Ampd1	T	C	3: 102,988,305 (GRCm39)	S83P	probably benign	Het
Bub1	G	A	2: 127,649,750 (GRCm39)	L703F	probably benign	Het
C1rb	T	A	6: 124,551,617 (GRCm39)	D242E	probably damaging	Het
Carf	T	A	1: 60,189,752 (GRCm39)	L659Q	possibly damaging	Het
Carmil3	A	G	14: 55,736,522 (GRCm39)	N662S	probably damaging	Het
Ccno	A	G	13: 113,124,678 (GRCm39)	S83G	possibly damaging	Het
Chd3	A	T	11: 69,245,252 (GRCm39)	Y1155*	probably null	Het
Clec16a	A	G	16: 10,394,527 (GRCm39)	E295G	probably benign	Het
Clnk	A	G	5: 38,952,253 (GRCm39)		probably null	Het
Clvs2	T	C	10: 33,498,855 (GRCm39)	D25G	possibly damaging	Het
Cnr2	C	T	4: 135,644,827 (GRCm39)	R302W	probably damaging	Het
Col20a1	A	G	2: 180,640,498 (GRCm39)	T594A	probably damaging	Het
Dclk3	C	T	9: 111,297,787 (GRCm39)	R444W	possibly damaging	Het
Dmxl1	T	C	18: 49,998,183 (GRCm39)	V761A	probably damaging	Het
Dnah7a	C	A	1: 53,512,063 (GRCm39)	K2999N	possibly damaging	Het
Dusp28	T	C	1: 92,834,906 (GRCm39)	S44P	probably damaging	Het
Enpep	T	G	3: 129,102,774 (GRCm39)	N394T	probably damaging	Het
Fam135a	A	T	1: 24,060,998 (GRCm39)	F1343I	probably damaging	Het
Fbxl12	C	A	9: 20,550,160 (GRCm39)	R165L	possibly damaging	Het
Fbxo40	A	T	16: 36,790,947 (GRCm39)	H54Q	probably damaging	Het
Galnt9	A	G	5: 110,744,111 (GRCm39)	D315G	probably benign	Het
Gbp4	T	A	5: 105,267,800 (GRCm39)	D482V	probably damaging	Het
Gm17175	T	A	14: 51,809,070 (GRCm39)	I99F	possibly damaging	Het
Heatr4	A	G	12: 84,027,104 (GRCm39)	F51S	probably benign	Het
Herc1	T	C	9: 66,415,442 (GRCm39)	S4806P	probably damaging	Het
Hoxc11	G	A	15: 102,863,177 (GRCm39)	V73I	possibly damaging	Het
Lcor	T	C	19: 41,573,888 (GRCm39)	I881T	possibly damaging	Het
Lipt2	T	C	7: 99,809,450 (GRCm39)	F179S	probably damaging	Het
Lrrc8b	G	A	5: 105,628,622 (GRCm39)	V323M	probably damaging	Het
Ltbp1	T	C	17: 75,599,852 (GRCm39)	S665P	probably benign	Het
Miga1	A	T	3: 152,028,045 (GRCm39)	D161E	probably benign	Het
Mynn	A	G	3: 30,657,933 (GRCm39)	T84A	probably benign	Het
Or13c7d	T	C	4: 43,770,598 (GRCm39)	S138G	possibly damaging	Het
Or3a1b	T	C	11: 74,012,492 (GRCm39)	F126L	probably benign	Het
Or4a75	A	T	2: 89,448,331 (GRCm39)	D68E	probably damaging	Het
Pik3r3	C	T	4: 116,079,572 (GRCm39)	S23L	probably benign	Het
Plat	G	T	8: 23,262,248 (GRCm39)	G91W	probably damaging	Het
Plscr4	C	T	9: 92,372,843 (GRCm39)	R322*	probably null	Het
Ralgapa1	A	G	12: 55,705,847 (GRCm39)	S1892P	probably damaging	Het
Slc6a18	T	A	13: 73,813,693 (GRCm39)	Q540L	probably benign	Het
Tfap2a	A	T	13: 40,872,706 (GRCm39)	N323K	possibly damaging	Het
Tgm1	A	T	14: 55,943,100 (GRCm39)	M580K	probably benign	Het
Tnrc6b	G	A	15: 80,813,619 (GRCm39)	G1792D	unknown	Het
Trim66	T	A	7: 109,074,599 (GRCm39)	Q554L	possibly damaging	Het
Ttc28	G	A	5: 111,381,207 (GRCm39)	D1240N	probably benign	Het
Vmn1r238	G	T	18: 3,123,365 (GRCm39)	C16*	probably null	Het
Vmn1r6	G	A	6: 56,979,495 (GRCm39)	M52I	probably benign	Het
Zfp61	A	G	7: 23,991,459 (GRCm39)	F231L	probably benign	Het

Other mutations in Knl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00272:Knl1	APN	2	118,894,564 (GRCm39)	missense	probably damaging	0.96
IGL00582:Knl1	APN	2	118,932,980 (GRCm39)	missense	probably benign	0.19
IGL00666:Knl1	APN	2	118,900,945 (GRCm39)	missense	probably damaging	0.96
IGL01062:Knl1	APN	2	118,907,461 (GRCm39)	missense	probably benign	0.33
IGL01395:Knl1	APN	2	118,902,047 (GRCm39)	missense	probably damaging	0.96
IGL01604:Knl1	APN	2	118,900,482 (GRCm39)	missense	probably damaging	1.00
IGL01996:Knl1	APN	2	118,934,542 (GRCm39)	missense	probably damaging	1.00
IGL02086:Knl1	APN	2	118,931,255 (GRCm39)	missense	probably benign	0.40
IGL02105:Knl1	APN	2	118,902,289 (GRCm39)	missense	probably benign
IGL02106:Knl1	APN	2	118,902,489 (GRCm39)	missense	possibly damaging	0.89
IGL02201:Knl1	APN	2	118,899,633 (GRCm39)	missense	probably benign	0.01
IGL02252:Knl1	APN	2	118,903,021 (GRCm39)	missense	probably damaging	1.00
IGL02414:Knl1	APN	2	118,900,804 (GRCm39)	missense	possibly damaging	0.83
IGL02655:Knl1	APN	2	118,901,473 (GRCm39)	missense	possibly damaging	0.62
IGL02682:Knl1	APN	2	118,908,450 (GRCm39)	missense	possibly damaging	0.86
IGL02710:Knl1	APN	2	118,901,411 (GRCm39)	missense	probably damaging	0.99
IGL02877:Knl1	APN	2	118,919,312 (GRCm39)	missense	probably benign	0.08
IGL03100:Knl1	APN	2	118,931,251 (GRCm39)	missense	probably damaging	0.99
IGL03210:Knl1	APN	2	118,901,098 (GRCm39)	missense	probably benign	0.02
IGL03138:Knl1	UTSW	2	118,902,840 (GRCm39)	missense	probably damaging	0.96
R0023:Knl1	UTSW	2	118,933,030 (GRCm39)	missense	possibly damaging	0.73
R0064:Knl1	UTSW	2	118,906,724 (GRCm39)	missense	probably benign	0.00
R0064:Knl1	UTSW	2	118,906,724 (GRCm39)	missense	probably benign	0.00
R0078:Knl1	UTSW	2	118,900,373 (GRCm39)	missense	probably benign	0.16
R0178:Knl1	UTSW	2	118,888,886 (GRCm39)	splice site	probably benign
R0295:Knl1	UTSW	2	118,919,320 (GRCm39)	missense	probably damaging	1.00
R0433:Knl1	UTSW	2	118,934,542 (GRCm39)	missense	probably damaging	0.96
R0453:Knl1	UTSW	2	118,898,869 (GRCm39)	missense	probably damaging	1.00
R0569:Knl1	UTSW	2	118,927,916 (GRCm39)	missense	possibly damaging	0.95
R0827:Knl1	UTSW	2	118,919,382 (GRCm39)	splice site	probably benign
R0920:Knl1	UTSW	2	118,900,309 (GRCm39)	missense	probably benign	0.00
R1120:Knl1	UTSW	2	118,892,856 (GRCm39)	missense	probably damaging	0.99
R1155:Knl1	UTSW	2	118,901,635 (GRCm39)	missense	possibly damaging	0.90
R1204:Knl1	UTSW	2	118,901,670 (GRCm39)	missense	probably benign	0.00
R1241:Knl1	UTSW	2	118,903,054 (GRCm39)	missense	probably benign	0.03
R1387:Knl1	UTSW	2	118,901,211 (GRCm39)	missense	possibly damaging	0.93
R1448:Knl1	UTSW	2	118,898,788 (GRCm39)	missense	probably damaging	1.00
R1469:Knl1	UTSW	2	118,901,827 (GRCm39)	missense	possibly damaging	0.73
R1469:Knl1	UTSW	2	118,901,827 (GRCm39)	missense	possibly damaging	0.73
R1719:Knl1	UTSW	2	118,902,219 (GRCm39)	missense	probably benign	0.01
R1721:Knl1	UTSW	2	118,906,815 (GRCm39)	missense	probably damaging	1.00
R2128:Knl1	UTSW	2	118,902,300 (GRCm39)	missense	possibly damaging	0.79
R2170:Knl1	UTSW	2	118,918,075 (GRCm39)	critical splice donor site	probably null
R2227:Knl1	UTSW	2	118,902,481 (GRCm39)	missense	probably damaging	0.97
R2246:Knl1	UTSW	2	118,902,708 (GRCm39)	missense	probably damaging	1.00
R2275:Knl1	UTSW	2	118,902,762 (GRCm39)	missense	probably damaging	0.99
R2508:Knl1	UTSW	2	118,888,849 (GRCm39)	nonsense	probably null
R3115:Knl1	UTSW	2	118,900,872 (GRCm39)	missense	possibly damaging	0.53
R3122:Knl1	UTSW	2	118,899,425 (GRCm39)	missense	probably benign	0.32
R3431:Knl1	UTSW	2	118,892,843 (GRCm39)	missense	probably damaging	1.00
R3755:Knl1	UTSW	2	118,933,060 (GRCm39)	missense	probably damaging	1.00
R4461:Knl1	UTSW	2	118,890,080 (GRCm39)	missense	probably benign	0.00
R4600:Knl1	UTSW	2	118,901,025 (GRCm39)	missense	possibly damaging	0.90
R4713:Knl1	UTSW	2	118,899,618 (GRCm39)	nonsense	probably null
R4758:Knl1	UTSW	2	118,902,213 (GRCm39)	frame shift	probably null
R4762:Knl1	UTSW	2	118,902,417 (GRCm39)	missense	probably benign	0.01
R4869:Knl1	UTSW	2	118,902,832 (GRCm39)	missense	possibly damaging	0.73
R4870:Knl1	UTSW	2	118,911,994 (GRCm39)	missense	probably benign	0.22
R4935:Knl1	UTSW	2	118,899,438 (GRCm39)	missense	possibly damaging	0.50
R5167:Knl1	UTSW	2	118,900,512 (GRCm39)	missense	probably damaging	1.00
R5184:Knl1	UTSW	2	118,899,657 (GRCm39)	missense	probably damaging	1.00
R5293:Knl1	UTSW	2	118,900,176 (GRCm39)	missense	probably damaging	0.99
R5326:Knl1	UTSW	2	118,898,829 (GRCm39)	missense	possibly damaging	0.66
R5331:Knl1	UTSW	2	118,900,736 (GRCm39)	missense	possibly damaging	0.92
R5353:Knl1	UTSW	2	118,901,464 (GRCm39)	missense	probably benign	0.01
R5493:Knl1	UTSW	2	118,899,211 (GRCm39)	missense	probably damaging	0.98
R5542:Knl1	UTSW	2	118,898,829 (GRCm39)	missense	possibly damaging	0.66
R5632:Knl1	UTSW	2	118,900,833 (GRCm39)	missense	probably damaging	1.00
R5650:Knl1	UTSW	2	118,912,031 (GRCm39)	nonsense	probably null
R5854:Knl1	UTSW	2	118,900,884 (GRCm39)	missense	probably benign	0.02
R5979:Knl1	UTSW	2	118,899,841 (GRCm39)	missense	possibly damaging	0.83
R6086:Knl1	UTSW	2	118,924,549 (GRCm39)	missense	probably damaging	1.00
R6283:Knl1	UTSW	2	118,900,767 (GRCm39)	missense	probably damaging	1.00
R6285:Knl1	UTSW	2	118,902,422 (GRCm39)	missense	probably damaging	1.00
R6313:Knl1	UTSW	2	118,899,799 (GRCm39)	missense	probably damaging	1.00
R6419:Knl1	UTSW	2	118,899,484 (GRCm39)	missense	probably benign	0.02
R6608:Knl1	UTSW	2	118,917,093 (GRCm39)	missense	probably damaging	0.99
R6881:Knl1	UTSW	2	118,925,665 (GRCm39)	missense	possibly damaging	0.67
R7161:Knl1	UTSW	2	118,901,266 (GRCm39)	missense	possibly damaging	0.79
R7206:Knl1	UTSW	2	118,899,780 (GRCm39)	missense	probably benign	0.35
R7270:Knl1	UTSW	2	118,933,003 (GRCm39)	missense	possibly damaging	0.53
R7276:Knl1	UTSW	2	118,902,167 (GRCm39)	missense	probably damaging	0.98
R7358:Knl1	UTSW	2	118,901,040 (GRCm39)	missense	possibly damaging	0.92
R7402:Knl1	UTSW	2	118,925,707 (GRCm39)	nonsense	probably null
R7408:Knl1	UTSW	2	118,901,073 (GRCm39)	missense	possibly damaging	0.54
R7475:Knl1	UTSW	2	118,918,027 (GRCm39)	missense	probably damaging	1.00
R7516:Knl1	UTSW	2	118,901,179 (GRCm39)	missense	probably damaging	0.99
R7524:Knl1	UTSW	2	118,896,460 (GRCm39)	missense	probably damaging	1.00
R7559:Knl1	UTSW	2	118,924,487 (GRCm39)	missense	possibly damaging	0.84
R7607:Knl1	UTSW	2	118,925,614 (GRCm39)	missense	possibly damaging	0.93
R7745:Knl1	UTSW	2	118,902,037 (GRCm39)	missense	probably benign	0.13
R7847:Knl1	UTSW	2	118,901,457 (GRCm39)	missense	probably benign	0.02
R8725:Knl1	UTSW	2	118,899,524 (GRCm39)	missense	probably benign	0.34
R8727:Knl1	UTSW	2	118,899,524 (GRCm39)	missense	probably benign	0.34
R8995:Knl1	UTSW	2	118,902,990 (GRCm39)	missense	probably benign	0.11
R9023:Knl1	UTSW	2	118,900,761 (GRCm39)	missense	probably benign	0.27
R9100:Knl1	UTSW	2	118,899,469 (GRCm39)	missense	probably benign	0.02
R9102:Knl1	UTSW	2	118,917,973 (GRCm39)	missense	probably benign	0.22
R9303:Knl1	UTSW	2	118,898,829 (GRCm39)	missense	possibly damaging	0.83
R9400:Knl1	UTSW	2	118,931,224 (GRCm39)	missense	probably damaging	0.98
R9426:Knl1	UTSW	2	118,899,979 (GRCm39)	missense	possibly damaging	0.81
R9583:Knl1	UTSW	2	118,887,782 (GRCm39)	missense	probably damaging	1.00
R9616:Knl1	UTSW	2	118,907,425 (GRCm39)	missense	probably damaging	1.00
R9616:Knl1	UTSW	2	118,899,994 (GRCm39)	missense	probably benign	0.02
R9671:Knl1	UTSW	2	118,901,089 (GRCm39)	missense	probably damaging	1.00
R9766:Knl1	UTSW	2	118,900,381 (GRCm39)	missense	probably damaging	1.00
R9782:Knl1	UTSW	2	118,899,910 (GRCm39)	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- GAACGTTCCTGCAGCAAACTC -3'
(R):5'- CATAGTCTTATCCAGATCACCAGG -3'

Sequencing Primer
(F):5'- GTTCCTGCAGCAAACTCTAGAGTAG -3'
(R):5'- TCACCAGGAGTTATATCACTGGGC -3'

Posted On

2020-10-20