Incidental Mutation 'R7652:Arhgap45'
ID590928
Institutional Source Beutler Lab
Gene Symbol Arhgap45
Ensembl Gene ENSMUSG00000035697
Gene NameRho GTPase activating protein 45
Synonyms6330406L22Rik, Hmha1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7652 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location80016653-80031472 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 80028838 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 908 (A908V)
Ref Sequence ENSEMBL: ENSMUSP00000101012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043311] [ENSMUST00000099501] [ENSMUST00000105373]
Predicted Effect probably benign
Transcript: ENSMUST00000043311
AA Change: A781V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000041019
Gene: ENSMUSG00000035697
AA Change: A781V

DomainStartEndE-ValueType
low complexity region 142 153 N/A INTRINSIC
FCH 157 244 4.14e-17 SMART
low complexity region 255 269 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
low complexity region 330 345 N/A INTRINSIC
low complexity region 527 536 N/A INTRINSIC
C1 582 628 3.15e-8 SMART
RhoGAP 653 852 2.73e-73 SMART
low complexity region 856 869 N/A INTRINSIC
Blast:RhoGAP 876 999 1e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000099501
AA Change: A897V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000097100
Gene: ENSMUSG00000035697
AA Change: A897V

DomainStartEndE-ValueType
low complexity region 258 269 N/A INTRINSIC
FCH 273 360 4.14e-17 SMART
low complexity region 371 385 N/A INTRINSIC
low complexity region 425 440 N/A INTRINSIC
low complexity region 446 461 N/A INTRINSIC
low complexity region 643 652 N/A INTRINSIC
C1 698 744 3.15e-8 SMART
RhoGAP 769 968 2.73e-73 SMART
low complexity region 972 985 N/A INTRINSIC
Blast:RhoGAP 992 1115 1e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000105373
AA Change: A908V

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000101012
Gene: ENSMUSG00000035697
AA Change: A908V

DomainStartEndE-ValueType
low complexity region 269 280 N/A INTRINSIC
FCH 284 371 4.14e-17 SMART
low complexity region 382 396 N/A INTRINSIC
low complexity region 436 451 N/A INTRINSIC
low complexity region 457 472 N/A INTRINSIC
low complexity region 654 663 N/A INTRINSIC
C1 709 755 3.15e-8 SMART
RhoGAP 780 979 2.73e-73 SMART
low complexity region 983 996 N/A INTRINSIC
Blast:RhoGAP 1003 1126 1e-21 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agrn A G 4: 156,169,218 probably null Het
Alb G C 5: 90,467,355 R242P probably damaging Het
Aph1b T C 9: 66,784,541 T195A probably benign Het
Apoe G T 7: 19,696,610 R236S possibly damaging Het
Arap3 G T 18: 37,978,452 T1137K probably damaging Het
Atp13a1 T C 8: 69,805,559 C965R probably damaging Het
C7 A G 15: 5,012,105 Y440H probably damaging Het
Cacna2d2 T C 9: 107,524,198 probably null Het
Ddah2 C A 17: 35,061,050 R173S possibly damaging Het
Dnajc11 T C 4: 151,974,225 Y337H probably damaging Het
Dnajc25 A G 4: 59,020,483 K302R probably benign Het
Dnajc6 A T 4: 101,606,677 Q209L probably damaging Het
Drosha G A 15: 12,859,436 V577I probably benign Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Ebf2 G T 14: 67,390,567 probably null Het
Epx A G 11: 87,875,334 probably null Het
Eqtn T C 4: 94,928,337 Y73C probably damaging Het
Fam107b A G 2: 3,772,847 N21S probably benign Het
Fasn G A 11: 120,816,328 S857F probably damaging Het
Fat1 A G 8: 44,953,299 N1029S probably damaging Het
Gas8 A G 8: 123,526,536 I208V probably benign Het
Gm11127 A T 17: 36,056,783 V221D probably damaging Het
Gm3269 T C 14: 4,839,095 I88T probably benign Het
Gm36079 A T 13: 120,026,993 S7T possibly damaging Het
Gm8005 C A 14: 42,436,962 L136F Het
Grid2ip C A 5: 143,382,638 P743Q probably damaging Het
Hbs1l C T 10: 21,364,760 T626I probably benign Het
Hdac3 T A 18: 37,954,919 probably benign Het
Hnrnpab T C 11: 51,605,573 Y94C probably damaging Het
Homer2 T C 7: 81,649,666 D17G probably damaging Het
Ikbke C T 1: 131,271,832 R308Q probably damaging Het
Ints10 A G 8: 68,825,119 T682A possibly damaging Het
Klhl3 G A 13: 58,113,332 probably benign Het
Klk9 A T 7: 43,796,090 T235S probably benign Het
Kmt2c T C 5: 25,315,719 T1798A probably benign Het
Kri1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTCCTCCTCCTC 9: 21,281,056 probably benign Het
Krtap4-6 T C 11: 99,665,614 I96V unknown Het
Lef1 A C 3: 131,200,354 R354S probably damaging Het
Lrp6 A T 6: 134,511,245 L296* probably null Het
Maml2 T C 9: 13,621,649 Y720H Het
Mmrn1 A G 6: 60,977,506 N924D probably benign Het
Myh7b A G 2: 155,632,236 K1624E probably damaging Het
Nos3 T A 5: 24,383,612 V1112D probably damaging Het
Olfr1136 A G 2: 87,693,360 I174T probably damaging Het
Olfr1216 C T 2: 89,013,549 V172I probably benign Het
Olfr1384 T C 11: 49,513,685 F16L probably damaging Het
Olfr1437 C A 19: 12,322,287 C180F probably damaging Het
Olfr814 A T 10: 129,874,477 N93K probably damaging Het
Phospho1 T C 11: 95,830,819 L105S probably damaging Het
Prss35 T A 9: 86,755,970 N264K probably benign Het
Ptpn13 A G 5: 103,529,712 D732G probably benign Het
Rab18 A T 18: 6,783,123 T64S possibly damaging Het
Rft1 A G 14: 30,677,816 Q319R probably benign Het
Rgs7 T A 1: 175,093,830 M220L probably benign Het
Rnf13 A G 3: 57,764,351 N28S probably benign Het
Setd3 A T 12: 108,112,289 I311N probably damaging Het
Setd5 G A 6: 113,121,764 R786H probably damaging Het
Slc26a6 T C 9: 108,855,944 probably null Het
Slc26a9 A T 1: 131,763,896 T626S probably benign Het
Stom A T 2: 35,316,029 N229K probably benign Het
Tlr1 A T 5: 64,926,787 L149* probably null Het
Trpc3 C A 3: 36,638,528 V772F probably benign Het
Ube3a A G 7: 59,243,354 probably benign Het
Ugt2b35 T A 5: 87,001,510 F207I probably damaging Het
Usp53 A T 3: 122,953,235 D360E possibly damaging Het
Vmn2r96 T G 17: 18,573,570 S59A probably benign Het
Wdr70 A G 15: 8,079,216 C149R probably benign Het
Wnt3 A G 11: 103,812,464 T258A possibly damaging Het
Zfp729b T C 13: 67,591,252 T965A probably benign Het
Other mutations in Arhgap45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Arhgap45 APN 10 80028648 splice site probably benign
IGL01414:Arhgap45 APN 10 80027104 missense probably damaging 1.00
IGL01505:Arhgap45 APN 10 80026542 missense probably benign 0.10
IGL02203:Arhgap45 APN 10 80027553 nonsense probably null
IGL02557:Arhgap45 APN 10 80021638 missense probably damaging 1.00
IGL02858:Arhgap45 APN 10 80017934 missense probably benign 0.20
IGL03292:Arhgap45 APN 10 80020969 missense probably benign 0.04
IGL03352:Arhgap45 APN 10 80030751 missense probably damaging 0.96
Celt UTSW 10 80020818 missense probably damaging 1.00
druid UTSW 10 80026347 critical splice donor site probably null
Mistletoe UTSW 10 80027102 nonsense probably null
Roman UTSW 10 80027597 missense probably damaging 1.00
stonehenge UTSW 10 80025482 missense possibly damaging 0.81
IGL03048:Arhgap45 UTSW 10 80017017 missense probably damaging 0.99
PIT4677001:Arhgap45 UTSW 10 80020749 missense probably benign
R0532:Arhgap45 UTSW 10 80022083 missense possibly damaging 0.92
R1233:Arhgap45 UTSW 10 80027582 missense probably damaging 1.00
R1579:Arhgap45 UTSW 10 80028977 missense probably damaging 1.00
R1666:Arhgap45 UTSW 10 80028750 missense possibly damaging 0.82
R1668:Arhgap45 UTSW 10 80028750 missense possibly damaging 0.82
R1688:Arhgap45 UTSW 10 80029095 missense probably damaging 1.00
R1710:Arhgap45 UTSW 10 80018098 nonsense probably null
R1902:Arhgap45 UTSW 10 80025466 missense probably damaging 0.99
R1912:Arhgap45 UTSW 10 80020690 missense probably benign 0.08
R1935:Arhgap45 UTSW 10 80030954 missense probably damaging 1.00
R1936:Arhgap45 UTSW 10 80030954 missense probably damaging 1.00
R1955:Arhgap45 UTSW 10 80026492 missense probably benign 0.15
R1968:Arhgap45 UTSW 10 80027702 missense probably damaging 1.00
R1977:Arhgap45 UTSW 10 80020818 missense probably damaging 1.00
R1986:Arhgap45 UTSW 10 80020696 missense probably damaging 1.00
R2074:Arhgap45 UTSW 10 80027180 missense probably damaging 1.00
R2081:Arhgap45 UTSW 10 80027674 missense probably damaging 1.00
R2162:Arhgap45 UTSW 10 80016979 start codon destroyed probably null 0.02
R2937:Arhgap45 UTSW 10 80029002 missense probably damaging 1.00
R2938:Arhgap45 UTSW 10 80029002 missense probably damaging 1.00
R3081:Arhgap45 UTSW 10 80026447 missense probably damaging 1.00
R4695:Arhgap45 UTSW 10 80025530 missense probably damaging 1.00
R4736:Arhgap45 UTSW 10 80026172 missense probably damaging 1.00
R4758:Arhgap45 UTSW 10 80030293 missense probably benign 0.00
R4860:Arhgap45 UTSW 10 80027066 missense probably damaging 1.00
R4860:Arhgap45 UTSW 10 80027066 missense probably damaging 1.00
R4934:Arhgap45 UTSW 10 80020957 missense probably damaging 1.00
R4943:Arhgap45 UTSW 10 80026503 missense probably benign 0.00
R5102:Arhgap45 UTSW 10 80021428 missense probably benign 0.01
R5128:Arhgap45 UTSW 10 80030959 missense probably benign 0.16
R5667:Arhgap45 UTSW 10 80025476 missense probably damaging 1.00
R5671:Arhgap45 UTSW 10 80025476 missense probably damaging 1.00
R5920:Arhgap45 UTSW 10 80029131 missense possibly damaging 0.87
R5998:Arhgap45 UTSW 10 80030950 missense probably damaging 0.99
R6276:Arhgap45 UTSW 10 80026234 missense probably benign 0.25
R6675:Arhgap45 UTSW 10 80018104 missense probably null 0.98
R6738:Arhgap45 UTSW 10 80027597 missense probably damaging 1.00
R6783:Arhgap45 UTSW 10 80017864 missense possibly damaging 0.92
R6863:Arhgap45 UTSW 10 80017782 missense probably benign 0.03
R6978:Arhgap45 UTSW 10 80021848 missense probably benign 0.00
R7089:Arhgap45 UTSW 10 80026347 critical splice donor site probably null
R7215:Arhgap45 UTSW 10 80025482 missense possibly damaging 0.81
R7307:Arhgap45 UTSW 10 80029182 missense probably benign 0.14
R7308:Arhgap45 UTSW 10 80026558 critical splice donor site probably null
R7480:Arhgap45 UTSW 10 80027102 nonsense probably null
R7481:Arhgap45 UTSW 10 80022300 missense possibly damaging 0.80
R7649:Arhgap45 UTSW 10 80031001 missense probably benign 0.00
R7748:Arhgap45 UTSW 10 80016932 unclassified probably benign
R7883:Arhgap45 UTSW 10 80027589 nonsense probably null
R7966:Arhgap45 UTSW 10 80027589 nonsense probably null
X0023:Arhgap45 UTSW 10 80030800 missense probably damaging 0.98
X0063:Arhgap45 UTSW 10 80030356 missense possibly damaging 0.51
Z1176:Arhgap45 UTSW 10 80025536 missense not run
Z1176:Arhgap45 UTSW 10 80029052 missense not run
Predicted Primers PCR Primer
(F):5'- TCTCTAAATGTGTCACCCTGCAG -3'
(R):5'- AACAGTGTGGGCCCGAAAAC -3'

Sequencing Primer
(F):5'- TAAATGTGTCACCCTGCAGCTACC -3'
(R):5'- CGAAAACGATGCCCAGGTTC -3'
Posted On2019-10-24