Mutagenetix > Incidental Mutations

Incidental Mutation 'R7660:Casc3'

591526

Institutional Source

Beutler Lab

Gene Symbol

Casc3

Ensembl Gene

ENSMUSG00000078676

Gene Name

cancer susceptibility candidate 3

Synonyms

Btz, Mln51

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.949) question?

Stock #

R7660 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

98804905-98833814 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 98809873 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 4 (R4G)

Ref Sequence

ENSEMBL: ENSMUSP00000130926 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017384] [ENSMUST00000037915] [ENSMUST00000037930] [ENSMUST00000107487] [ENSMUST00000169695]

Predicted Effect

unknown
Transcript: ENSMUST00000017384
AA Change: R4G

SMART Domains

Protein: ENSMUSP00000017384
Gene: ENSMUSG00000078676
AA Change: R4G

Domain	Start	End	E-Value	Type
low complexity region	18	62	N/A	INTRINSIC
low complexity region	64	84	N/A	INTRINSIC
low complexity region	89	109	N/A	INTRINSIC
low complexity region	123	136	N/A	INTRINSIC
Btz	138	246	1.02e-57	SMART
low complexity region	524	533	N/A	INTRINSIC
low complexity region	586	614	N/A	INTRINSIC
low complexity region	627	648	N/A	INTRINSIC
low complexity region	669	684	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000037915

SMART Domains

Protein: ENSMUSP00000042792
Gene: ENSMUSG00000052915

Domain	Start	End	E-Value	Type
low complexity region	10	15	N/A	INTRINSIC
low complexity region	55	91	N/A	INTRINSIC
low complexity region	153	196	N/A	INTRINSIC
Pfam:MSL1_dimer	216	252	5e-22	PFAM
low complexity region	289	300	N/A	INTRINSIC
low complexity region	441	453	N/A	INTRINSIC
PEHE	475	593	1.8e-41	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000037930

SMART Domains

Protein: ENSMUSP00000043328
Gene: ENSMUSG00000052915

Domain	Start	End	E-Value	Type
coiled coil region	18	56	N/A	INTRINSIC
low complexity region	59	70	N/A	INTRINSIC
low complexity region	211	223	N/A	INTRINSIC
PEHE	229	347	2.73e-41	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000107487

SMART Domains

Protein: ENSMUSP00000103111
Gene: ENSMUSG00000052915

Domain	Start	End	E-Value	Type
low complexity region	10	15	N/A	INTRINSIC
low complexity region	55	91	N/A	INTRINSIC
low complexity region	153	196	N/A	INTRINSIC
low complexity region	210	222	N/A	INTRINSIC
SCOP:d1fxkc_	235	307	6e-3	SMART
low complexity region	441	453	N/A	INTRINSIC
PEHE	459	577	2.73e-41	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000169695
AA Change: R4G

SMART Domains

Protein: ENSMUSP00000130926
Gene: ENSMUSG00000078676
AA Change: R4G

Domain	Start	End	E-Value	Type
low complexity region	18	62	N/A	INTRINSIC
low complexity region	64	84	N/A	INTRINSIC
low complexity region	89	109	N/A	INTRINSIC
low complexity region	123	136	N/A	INTRINSIC
Btz	138	246	1.02e-57	SMART
low complexity region	524	533	N/A	INTRINSIC
low complexity region	586	614	N/A	INTRINSIC
low complexity region	627	648	N/A	INTRINSIC
low complexity region	669	684	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.3%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a core component of the exon junction complex (EJC), a protein complex that is deposited on spliced mRNAs at exon-exon junctions and functions in nonsense-mediated mRNA decay (NMD). The encoded protein binds RNA and interacts with two other EJC core components. It is predominantly located in the cytoplasm, but shuttles into the nucleus where it localizes to nuclear speckles. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygosity for a null or hypomorphic allele causes embryonic and postnatal lethality, respectively. Compound heterozygous embryos are smaller and exhibit proportionately reduced brain size with fewer neurons and progenitors, but no apoptosis, largely due to developmental delay. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933427I04Rik	A	T	4: 123,860,719	H142L	possibly damaging	Het
Abca13	A	G	11: 9,290,678	E847G	probably benign	Het
Abca9	T	A	11: 110,115,452	T1276S	probably benign	Het
Abcb11	C	T	2: 69,287,594		probably null	Het
AF366264	A	T	8: 13,837,995	I32K	probably benign	Het
Alpk1	G	C	3: 127,680,967	H462Q	probably damaging	Het
Armh1	C	A	4: 117,213,741	A396S	probably benign	Het
Atm	C	T	9: 53,445,507	V2815M	probably benign	Het
Braf	T	C	6: 39,623,641	I681V	possibly damaging	Het
Crybg1	T	C	10: 43,998,835	D759G	probably damaging	Het
Csrp2	A	G	10: 110,937,763	N103S	probably benign	Het
Faf1	A	T	4: 109,861,837	H380L	probably damaging	Het
Farp1	G	A	14: 121,276,922	A888T	probably benign	Het
Fat4	A	T	3: 38,981,160	Q2987L	probably benign	Het
Fkbp15	T	A	4: 62,314,341	T665S	probably benign	Het
Gigyf1	T	C	5: 137,520,969	S343P	probably benign	Het
Glrx3	A	G	7: 137,459,225	Y196C	probably damaging	Het
Gm3278	T	G	14: 4,893,349	L66R	probably damaging	Het
Gm8298	A	G	3: 59,865,268	I64M	probably benign	Het
Ick	G	C	9: 78,167,620	V586L	probably benign	Het
Ifi205	A	G	1: 174,028,248	V72A	probably benign	Het
Ift140	T	G	17: 25,051,824	L708R	probably damaging	Het
Ints13	A	T	6: 146,557,338	L328M	probably benign	Het
Itfg2	A	G	6: 128,424,746	I23T	probably damaging	Het
Ldha	C	T	7: 46,850,257	P100S	unknown	Het
Lmtk2	T	A	5: 144,148,340	L210H	probably damaging	Het
Lrrc4	T	A	6: 28,829,817	I600L	probably benign	Het
Map2	C	A	1: 66,414,377	P809T	probably damaging	Het
Matn2	A	G	15: 34,402,946	K439R	probably benign	Het
Matn2	T	A	15: 34,423,728	C577*	probably null	Het
Mep1a	C	T	17: 43,478,977	G494S	probably benign	Het
Mtmr4	T	C	11: 87,604,580	F488L	probably damaging	Het
Mtus1	G	T	8: 41,016,211	T8K	probably benign	Het
Mug1	C	A	6: 121,861,220	H470N	possibly damaging	Het
Mybpc1	T	C	10: 88,548,854	T523A	possibly damaging	Het
Ncoa3	C	T	2: 166,069,321	P1334S	probably benign	Het
Neb	T	G	2: 52,249,439	M119L		Het
Nox4	T	C	7: 87,370,022	Y408H	probably damaging	Het
Nxpe3	C	T	16: 55,844,327	R510Q	probably damaging	Het
Olfr1077-ps1	A	T	2: 86,525,830	S116T	possibly damaging	Het
Olfr1275	C	T	2: 111,231,615	M59I	probably damaging	Het
Olfr48	T	C	2: 89,844,443	T177A	probably benign	Het
Olfr484	A	G	7: 108,124,834	V143A	probably benign	Het
Olfr807	C	A	10: 129,754,563	E296*	probably null	Het
Olfr839-ps1	T	C	9: 19,175,508	H56R	probably benign	Het
Paip1	C	T	13: 119,450,770	T390I	possibly damaging	Het
Pax8	T	C	2: 24,436,561	Y263C	probably benign	Het
Pcdha11	T	A	18: 37,005,851	Y178N	probably benign	Het
Pcdhga11	C	T	18: 37,757,130	T397M	possibly damaging	Het
Pdlim5	G	T	3: 142,259,185	H428N	probably damaging	Het
Pigg	G	A	5: 108,338,619	V713I	probably benign	Het
Rgs3	A	G	4: 62,701,112	D478G	possibly damaging	Het
Scgb2b11	C	T	7: 32,210,458	E68K	probably damaging	Het
Sema4b	C	A	7: 80,220,247	Q428K	probably benign	Het
Serpine2	T	C	1: 79,802,905	T276A	probably benign	Het
Sgo2b	G	A	8: 63,940,074	H110Y	probably benign	Het
Slc12a7	T	C	13: 73,806,089	L833S	probably benign	Het
Slc6a15	T	A	10: 103,393,380		probably null	Het
Srfbp1	G	A	18: 52,475,599	V24I	probably damaging	Het
Stpg2	A	T	3: 139,701,697	N537Y	probably damaging	Het
Svep1	A	T	4: 58,087,782	S1766T	probably benign	Het
Tiam2	T	A	17: 3,482,605	M1K	probably null	Het
Tmem245	A	T	4: 56,899,170	I661K	possibly damaging	Het
Trim5	T	C	7: 104,279,362	H124R	probably damaging	Het
Trim67	T	A	8: 124,820,285	L478Q	probably damaging	Het
Triml2	A	G	8: 43,193,320	D282G	probably damaging	Het
Txndc11	T	C	16: 11,087,929	Y579C	probably damaging	Het
Ube3c	T	A	5: 29,619,631	D551E	probably damaging	Het
Vmn1r194	T	C	13: 22,244,597	V128A	not run	Het
Vmn2r70	T	G	7: 85,568,922	N56T	probably damaging	Het
Vmn2r-ps130	T	A	17: 23,077,032	D725E	probably damaging	Het
Wdr95	T	C	5: 149,594,480	V501A	possibly damaging	Het
Zc3h8	T	C	2: 128,930,822	T249A	probably damaging	Het
Zfp54	T	C	17: 21,434,239	C332R	probably damaging	Het

Other mutations in Casc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Casc3	APN	11	98823202	missense	possibly damaging	0.62
IGL01566:Casc3	APN	11	98823401	critical splice donor site	probably null
IGL01901:Casc3	APN	11	98823121	missense	probably damaging	1.00
IGL02345:Casc3	APN	11	98827564	splice site	probably benign
IGL02875:Casc3	APN	11	98821552	missense	probably damaging	1.00
IGL02964:Casc3	APN	11	98828923	missense	probably damaging	0.96
R0147:Casc3	UTSW	11	98822499	missense	possibly damaging	0.89
R0195:Casc3	UTSW	11	98821493	missense	probably damaging	0.99
R0763:Casc3	UTSW	11	98831318	missense	probably damaging	1.00
R1581:Casc3	UTSW	11	98822818	missense	possibly damaging	0.66
R2021:Casc3	UTSW	11	98821506	missense	probably benign	0.01
R4380:Casc3	UTSW	11	98823031	missense	possibly damaging	0.67
R4612:Casc3	UTSW	11	98822958	missense	probably benign	0.13
R4988:Casc3	UTSW	11	98821874	splice site	probably null
R5079:Casc3	UTSW	11	98810426	intron	probably benign
R5442:Casc3	UTSW	11	98821471	missense	probably damaging	0.99
R5511:Casc3	UTSW	11	98810914	nonsense	probably null
R5873:Casc3	UTSW	11	98821444	missense	unknown
R6041:Casc3	UTSW	11	98828559	missense	probably damaging	1.00
R6685:Casc3	UTSW	11	98822530	missense	probably damaging	0.99
R7030:Casc3	UTSW	11	98822533	missense	possibly damaging	0.74
R7107:Casc3	UTSW	11	98827587	missense	possibly damaging	0.93
R7594:Casc3	UTSW	11	98821485	missense	probably benign	0.04
R7659:Casc3	UTSW	11	98809873	missense	unknown
R8443:Casc3	UTSW	11	98822781	missense	probably damaging	1.00
R8444:Casc3	UTSW	11	98822781	missense	probably damaging	1.00
R8491:Casc3	UTSW	11	98823151	missense	probably benign	0.27
R8516:Casc3	UTSW	11	98822781	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCACCGACAGACGTCATCTC -3'
(R):5'- GCATCTCACAGCATCTCCAG -3'

Sequencing Primer
(F):5'- TCTCGCTCTCCAGAAAACGTG -3'
(R):5'- ACACTCAGACTCCTCGGCG -3'

Posted On

2019-11-12