Incidental Mutation 'R7660:Casc3'
ID 591526
Institutional Source Beutler Lab
Gene Symbol Casc3
Ensembl Gene ENSMUSG00000078676
Gene Name exon junction complex subunit
Synonyms Mln51, Btz
MMRRC Submission 045735-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.954) question?
Stock # R7660 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 98700634-98724633 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 98700699 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 4 (R4G)
Ref Sequence ENSEMBL: ENSMUSP00000130926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017384] [ENSMUST00000037915] [ENSMUST00000037930] [ENSMUST00000107487] [ENSMUST00000169695]
AlphaFold Q8K3W3
Predicted Effect unknown
Transcript: ENSMUST00000017384
AA Change: R4G
SMART Domains Protein: ENSMUSP00000017384
Gene: ENSMUSG00000078676
AA Change: R4G

DomainStartEndE-ValueType
low complexity region 18 62 N/A INTRINSIC
low complexity region 64 84 N/A INTRINSIC
low complexity region 89 109 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Btz 138 246 1.02e-57 SMART
low complexity region 524 533 N/A INTRINSIC
low complexity region 586 614 N/A INTRINSIC
low complexity region 627 648 N/A INTRINSIC
low complexity region 669 684 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000037915
SMART Domains Protein: ENSMUSP00000042792
Gene: ENSMUSG00000052915

DomainStartEndE-ValueType
low complexity region 10 15 N/A INTRINSIC
low complexity region 55 91 N/A INTRINSIC
low complexity region 153 196 N/A INTRINSIC
Pfam:MSL1_dimer 216 252 5e-22 PFAM
low complexity region 289 300 N/A INTRINSIC
low complexity region 441 453 N/A INTRINSIC
PEHE 475 593 1.8e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000037930
SMART Domains Protein: ENSMUSP00000043328
Gene: ENSMUSG00000052915

DomainStartEndE-ValueType
coiled coil region 18 56 N/A INTRINSIC
low complexity region 59 70 N/A INTRINSIC
low complexity region 211 223 N/A INTRINSIC
PEHE 229 347 2.73e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107487
SMART Domains Protein: ENSMUSP00000103111
Gene: ENSMUSG00000052915

DomainStartEndE-ValueType
low complexity region 10 15 N/A INTRINSIC
low complexity region 55 91 N/A INTRINSIC
low complexity region 153 196 N/A INTRINSIC
low complexity region 210 222 N/A INTRINSIC
SCOP:d1fxkc_ 235 307 6e-3 SMART
low complexity region 441 453 N/A INTRINSIC
PEHE 459 577 2.73e-41 SMART
Predicted Effect unknown
Transcript: ENSMUST00000169695
AA Change: R4G
SMART Domains Protein: ENSMUSP00000130926
Gene: ENSMUSG00000078676
AA Change: R4G

DomainStartEndE-ValueType
low complexity region 18 62 N/A INTRINSIC
low complexity region 64 84 N/A INTRINSIC
low complexity region 89 109 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Btz 138 246 1.02e-57 SMART
low complexity region 524 533 N/A INTRINSIC
low complexity region 586 614 N/A INTRINSIC
low complexity region 627 648 N/A INTRINSIC
low complexity region 669 684 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a core component of the exon junction complex (EJC), a protein complex that is deposited on spliced mRNAs at exon-exon junctions and functions in nonsense-mediated mRNA decay (NMD). The encoded protein binds RNA and interacts with two other EJC core components. It is predominantly located in the cytoplasm, but shuttles into the nucleus where it localizes to nuclear speckles. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygosity for a null or hypomorphic allele causes embryonic and postnatal lethality, respectively. Compound heterozygous embryos are smaller and exhibit proportionately reduced brain size with fewer neurons and progenitors, but no apoptosis, largely due to developmental delay. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427I04Rik A T 4: 123,754,512 (GRCm39) H142L possibly damaging Het
Aadacl2fm3 A G 3: 59,772,689 (GRCm39) I64M probably benign Het
Abca13 A G 11: 9,240,678 (GRCm39) E847G probably benign Het
Abca9 T A 11: 110,006,278 (GRCm39) T1276S probably benign Het
Abcb11 C T 2: 69,117,938 (GRCm39) probably null Het
Alpk1 G C 3: 127,474,616 (GRCm39) H462Q probably damaging Het
Armh1 C A 4: 117,070,938 (GRCm39) A396S probably benign Het
Atm C T 9: 53,356,807 (GRCm39) V2815M probably benign Het
Braf T C 6: 39,600,575 (GRCm39) I681V possibly damaging Het
Cilk1 G C 9: 78,074,902 (GRCm39) V586L probably benign Het
Crybg1 T C 10: 43,874,831 (GRCm39) D759G probably damaging Het
Csrp2 A G 10: 110,773,624 (GRCm39) N103S probably benign Het
Faf1 A T 4: 109,719,034 (GRCm39) H380L probably damaging Het
Farp1 G A 14: 121,514,334 (GRCm39) A888T probably benign Het
Fat4 A T 3: 39,035,309 (GRCm39) Q2987L probably benign Het
Fkbp15 T A 4: 62,232,578 (GRCm39) T665S probably benign Het
Gigyf1 T C 5: 137,519,231 (GRCm39) S343P probably benign Het
Glrx3 A G 7: 137,060,954 (GRCm39) Y196C probably damaging Het
Gm3278 T G 14: 16,080,387 (GRCm39) L66R probably damaging Het
Ifi205 A G 1: 173,855,814 (GRCm39) V72A probably benign Het
Ift140 T G 17: 25,270,798 (GRCm39) L708R probably damaging Het
Ints13 A T 6: 146,458,836 (GRCm39) L328M probably benign Het
Itfg2 A G 6: 128,401,709 (GRCm39) I23T probably damaging Het
Ldha C T 7: 46,499,681 (GRCm39) P100S unknown Het
Lmtk2 T A 5: 144,085,158 (GRCm39) L210H probably damaging Het
Lrrc4 T A 6: 28,829,816 (GRCm39) I600L probably benign Het
Map2 C A 1: 66,453,536 (GRCm39) P809T probably damaging Het
Matn2 T A 15: 34,423,874 (GRCm39) C577* probably null Het
Matn2 A G 15: 34,403,092 (GRCm39) K439R probably benign Het
Mep1a C T 17: 43,789,868 (GRCm39) G494S probably benign Het
Mtmr4 T C 11: 87,495,406 (GRCm39) F488L probably damaging Het
Mtus1 G T 8: 41,469,248 (GRCm39) T8K probably benign Het
Mug1 C A 6: 121,838,179 (GRCm39) H470N possibly damaging Het
Mybpc1 T C 10: 88,384,716 (GRCm39) T523A possibly damaging Het
Ncoa3 C T 2: 165,911,241 (GRCm39) P1334S probably benign Het
Neb T G 2: 52,139,451 (GRCm39) M119L Het
Nox4 T C 7: 87,019,230 (GRCm39) Y408H probably damaging Het
Nxpe3 C T 16: 55,664,690 (GRCm39) R510Q probably damaging Het
Or4c58 T C 2: 89,674,787 (GRCm39) T177A probably benign Het
Or4f52 C T 2: 111,061,960 (GRCm39) M59I probably damaging Het
Or5p60 A G 7: 107,724,041 (GRCm39) V143A probably benign Het
Or6c214 C A 10: 129,590,432 (GRCm39) E296* probably null Het
Or7g23 T C 9: 19,086,804 (GRCm39) H56R probably benign Het
Or8k31-ps1 A T 2: 86,356,174 (GRCm39) S116T possibly damaging Het
Paip1 C T 13: 119,587,306 (GRCm39) T390I possibly damaging Het
Pax8 T C 2: 24,326,573 (GRCm39) Y263C probably benign Het
Pcdha11 T A 18: 37,138,904 (GRCm39) Y178N probably benign Het
Pcdhga11 C T 18: 37,890,183 (GRCm39) T397M possibly damaging Het
Pdlim5 G T 3: 141,964,946 (GRCm39) H428N probably damaging Het
Pigg G A 5: 108,486,485 (GRCm39) V713I probably benign Het
Rgs3 A G 4: 62,619,349 (GRCm39) D478G possibly damaging Het
Scgb2b11 C T 7: 31,909,883 (GRCm39) E68K probably damaging Het
Sema4b C A 7: 79,869,995 (GRCm39) Q428K probably benign Het
Semp2l2a A T 8: 13,887,995 (GRCm39) I32K probably benign Het
Serpine2 T C 1: 79,780,622 (GRCm39) T276A probably benign Het
Sgo2b G A 8: 64,393,108 (GRCm39) H110Y probably benign Het
Slc12a7 T C 13: 73,954,208 (GRCm39) L833S probably benign Het
Slc6a15 T A 10: 103,229,241 (GRCm39) probably null Het
Srfbp1 G A 18: 52,608,671 (GRCm39) V24I probably damaging Het
Stpg2 A T 3: 139,407,458 (GRCm39) N537Y probably damaging Het
Svep1 A T 4: 58,087,782 (GRCm39) S1766T probably benign Het
Tiam2 T A 17: 3,532,880 (GRCm39) M1K probably null Het
Tmem245 A T 4: 56,899,170 (GRCm39) I661K possibly damaging Het
Trim5 T C 7: 103,928,569 (GRCm39) H124R probably damaging Het
Trim67 T A 8: 125,547,024 (GRCm39) L478Q probably damaging Het
Triml2 A G 8: 43,646,357 (GRCm39) D282G probably damaging Het
Txndc11 T C 16: 10,905,793 (GRCm39) Y579C probably damaging Het
Ube3c T A 5: 29,824,629 (GRCm39) D551E probably damaging Het
Vmn1r194 T C 13: 22,428,767 (GRCm39) V128A not run Het
Vmn2r130 T A 17: 23,296,006 (GRCm39) D725E probably damaging Het
Vmn2r70 T G 7: 85,218,130 (GRCm39) N56T probably damaging Het
Wdr95 T C 5: 149,517,945 (GRCm39) V501A possibly damaging Het
Zc3h8 T C 2: 128,772,742 (GRCm39) T249A probably damaging Het
Zfp54 T C 17: 21,654,501 (GRCm39) C332R probably damaging Het
Other mutations in Casc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Casc3 APN 11 98,714,028 (GRCm39) missense possibly damaging 0.62
IGL01566:Casc3 APN 11 98,714,227 (GRCm39) critical splice donor site probably null
IGL01901:Casc3 APN 11 98,713,947 (GRCm39) missense probably damaging 1.00
IGL02345:Casc3 APN 11 98,718,390 (GRCm39) splice site probably benign
IGL02875:Casc3 APN 11 98,712,378 (GRCm39) missense probably damaging 1.00
IGL02964:Casc3 APN 11 98,719,749 (GRCm39) missense probably damaging 0.96
R0147:Casc3 UTSW 11 98,713,325 (GRCm39) missense possibly damaging 0.89
R0195:Casc3 UTSW 11 98,712,319 (GRCm39) missense probably damaging 0.99
R0763:Casc3 UTSW 11 98,722,144 (GRCm39) missense probably damaging 1.00
R1581:Casc3 UTSW 11 98,713,644 (GRCm39) missense possibly damaging 0.66
R2021:Casc3 UTSW 11 98,712,332 (GRCm39) missense probably benign 0.01
R4380:Casc3 UTSW 11 98,713,857 (GRCm39) missense possibly damaging 0.67
R4612:Casc3 UTSW 11 98,713,784 (GRCm39) missense probably benign 0.13
R4988:Casc3 UTSW 11 98,712,700 (GRCm39) splice site probably null
R5079:Casc3 UTSW 11 98,701,252 (GRCm39) intron probably benign
R5442:Casc3 UTSW 11 98,712,297 (GRCm39) missense probably damaging 0.99
R5511:Casc3 UTSW 11 98,701,740 (GRCm39) nonsense probably null
R5873:Casc3 UTSW 11 98,712,270 (GRCm39) missense unknown
R6041:Casc3 UTSW 11 98,719,385 (GRCm39) missense probably damaging 1.00
R6685:Casc3 UTSW 11 98,713,356 (GRCm39) missense probably damaging 0.99
R7030:Casc3 UTSW 11 98,713,359 (GRCm39) missense possibly damaging 0.74
R7107:Casc3 UTSW 11 98,718,413 (GRCm39) missense possibly damaging 0.93
R7594:Casc3 UTSW 11 98,712,311 (GRCm39) missense probably benign 0.04
R7659:Casc3 UTSW 11 98,700,699 (GRCm39) missense unknown
R8443:Casc3 UTSW 11 98,713,607 (GRCm39) missense probably damaging 1.00
R8444:Casc3 UTSW 11 98,713,607 (GRCm39) missense probably damaging 1.00
R8491:Casc3 UTSW 11 98,713,977 (GRCm39) missense probably benign 0.27
R8516:Casc3 UTSW 11 98,713,607 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACCGACAGACGTCATCTC -3'
(R):5'- GCATCTCACAGCATCTCCAG -3'

Sequencing Primer
(F):5'- TCTCGCTCTCCAGAAAACGTG -3'
(R):5'- ACACTCAGACTCCTCGGCG -3'
Posted On 2019-11-12