Mutagenetix > Incidental Mutation

Incidental Mutation 'R7757:Rnf216'

597600

Institutional Source

Beutler Lab

Gene Symbol

Rnf216

Ensembl Gene

ENSMUSG00000045078

Gene Name

ring finger protein 216

Synonyms

2810055G22Rik, Ubce7ip1, F830018F18Rik, UIP83

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7757 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

142990893-143112994 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 143080236 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 532 (K532N)

Ref Sequence

ENSEMBL: ENSMUSP00000143705 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053498] [ENSMUST00000197296] [ENSMUST00000200430] [ENSMUST00000200607]

AlphaFold

P58283

Predicted Effect

probably damaging
Transcript: ENSMUST00000053498
AA Change: K475N

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000052563
Gene: ENSMUSG00000045078
AA Change: K475N

Domain	Start	End	E-Value	Type
Blast:RING	560	620	4e-6	BLAST
IBR	629	693	6.82e-5	SMART
IBR	702	769	1.79e-1	SMART
low complexity region	786	803	N/A	INTRINSIC
low complexity region	842	866	N/A	INTRINSIC
low complexity region	869	881	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000197296

Predicted Effect

probably benign
Transcript: ENSMUST00000200430

Predicted Effect

probably damaging
Transcript: ENSMUST00000200607
AA Change: K532N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000143705
Gene: ENSMUSG00000045078
AA Change: K532N

Domain	Start	End	E-Value	Type
Blast:RING	560	620	4e-6	BLAST
IBR	629	693	6.82e-5	SMART
IBR	702	769	1.79e-1	SMART
low complexity region	786	803	N/A	INTRINSIC
low complexity region	842	866	N/A	INTRINSIC
low complexity region	869	881	N/A	INTRINSIC

Meta Mutation Damage Score

0.1394

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

96% (70/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein which specifically colocalizes and interacts with the serine/threonine protein kinase, receptor-interacting protein (RIP). Zinc finger domains of the encoded protein are required for its interaction with RIP and for inhibition of TNF- and IL1-induced NF-kappa B activation pathways. The encoded protein may also function as an E3 ubiquitin-protein ligase which accepts ubiquitin from E2 ubiquitin-conjugating enzymes and transfers it to substrates. Several alternatively spliced transcript variants have been described for this locus but the full-length natures of only some are known. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	A	T	15: 8,252,227	E2850V	unknown	Het
2700049A03Rik	G	A	12: 71,189,413	M1179I	probably benign	Het
6430550D23Rik	T	C	2: 156,003,431	T18A	possibly damaging	Het
Acox2	T	C	14: 8,230,166	N659S	probably damaging	Het
Agk	T	C	6: 40,376,278	V192A	possibly damaging	Het
Ap3b1	T	A	13: 94,528,158		probably null	Het
Bche	T	A	3: 73,701,121	D324V	probably damaging	Het
Bsn	A	G	9: 108,114,740	I1271T	possibly damaging	Het
Capn12	T	C	7: 28,882,821	L120P	probably damaging	Het
Cep290	T	A	10: 100,563,434	S2273T	probably benign	Het
Ckap4	T	C	10: 84,528,467	E244G	probably damaging	Het
Clcn7	T	C	17: 25,156,822	Y545H	probably damaging	Het
Cmya5	T	A	13: 93,098,272	T103S	possibly damaging	Het
Cpne9	G	A	6: 113,284,445	V121M	possibly damaging	Het
Csmd2	T	A	4: 128,483,456	I2043N		Het
Disc1	A	G	8: 125,087,504	T36A	probably benign	Het
Disp2	T	C	2: 118,790,910	Y708H	probably damaging	Het
Dnah3	A	G	7: 120,071,570	V635A	probably benign	Het
Dnah3	A	T	7: 119,971,215		probably null	Het
Dync1li1	A	G	9: 114,709,277	H234R	possibly damaging	Het
Egfr	T	C	11: 16,889,966	V660A	possibly damaging	Het
Epb42	T	C	2: 121,027,719	R253G	possibly damaging	Het
Fat2	T	A	11: 55,311,421	T276S	probably benign	Het
Fcho2	A	G	13: 98,764,503		probably null	Het
Ginm1	A	T	10: 7,779,355	I41N	probably damaging	Het
Gm4744	A	G	6: 40,950,433		probably benign	Het
Gm49368	C	T	7: 128,112,226	R701C	probably damaging	Het
Gpr37	T	A	6: 25,688,208	I297F	probably benign	Het
Gprc5a	T	A	6: 135,079,344	I263N	possibly damaging	Het
Gys2	A	T	6: 142,454,451	S345T	probably benign	Het
Hk2	T	C	6: 82,742,915	M255V	possibly damaging	Het
Ibtk	A	C	9: 85,697,237	S1202A	possibly damaging	Het
Il23r	T	G	6: 67,423,981	D455A	probably benign	Het
Irs2	T	A	8: 11,006,522	K637*	probably null	Het
Jak2	T	C	19: 29,283,546	V314A	probably benign	Het
Mei1	C	T	15: 82,082,623		probably benign	Het
Mill1	T	C	7: 18,262,466	M69T	probably benign	Het
Mms22l	T	C	4: 24,598,884		probably null	Het
Mup8	C	A	4: 60,220,332	Q133H	probably benign	Het
Mup8	T	A	4: 60,220,333	Q133L	probably benign	Het
Mycbp2	A	T	14: 103,191,619	Y2374N	probably damaging	Het
Nbeal1	A	T	1: 60,257,450	K1166N	probably damaging	Het
Nlrc4	T	A	17: 74,448,196	R8S	probably benign	Het
Nrcam	C	T	12: 44,549,898	Q25*	probably null	Het
Nudt16	A	C	9: 105,131,561	M47R	probably damaging	Het
Nup62	T	C	7: 44,828,995	S145P	probably benign	Het
Olfr1222	T	C	2: 89,124,989	I247M	possibly damaging	Het
Olfr959	A	G	9: 39,572,465	W265R	probably benign	Het
Osbpl1a	A	T	18: 12,933,600	V34D	probably benign	Het
Otogl	T	A	10: 107,876,921	N521Y	probably damaging	Het
Pcdhb14	T	A	18: 37,449,834	D664E	possibly damaging	Het
Pex5l	T	C	3: 33,082,151		probably benign	Het
Pkhd1	A	G	1: 20,562,415	L592P	probably damaging	Het
Plxdc2	A	G	2: 16,729,376	H480R	probably benign	Het
Schip1	C	A	3: 68,617,695	Q358K	probably damaging	Het
Sdc2	A	T	15: 33,028,087	E117V	possibly damaging	Het
Sept11	A	T	5: 93,171,464		probably null	Het
Shprh	A	T	10: 11,162,180	E420V	probably benign	Het
Ska1	T	A	18: 74,196,973	H232L	probably benign	Het
Slc36a4	A	G	9: 15,719,660	N25S	possibly damaging	Het
Slitrk3	G	A	3: 73,050,839	T200M	probably damaging	Het
Smad2	C	T	18: 76,288,013	H138Y	probably benign	Het
Snx21	T	C	2: 164,786,165	S34P	probably damaging	Het
Sos2	A	G	12: 69,648,585	V126A	probably damaging	Het
Srcap	C	T	7: 127,530,794	T596I	probably damaging	Het
Stk31	T	G	6: 49,406,943		probably null	Het
Stox1	T	C	10: 62,663,964	D939G	probably damaging	Het
Syne2	G	T	12: 76,061,779	C979F	possibly damaging	Het
Tanc2	C	A	11: 105,776,858	N88K	possibly damaging	Het
Tll2	A	T	19: 41,096,008	V677E	probably damaging	Het
Ttn	T	C	2: 76,918,490	T4072A	probably benign	Het
Unc13b	CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC	CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC	4: 43,177,312		probably benign	Het
Unc13b	AGAGCC	AGAGCCCGAGCC	4: 43,177,330		probably benign	Het
Unc13b	CAGAGC	CAGAGCGAGAGC	4: 43,177,341		probably benign	Het
Vmn2r43	A	T	7: 8,255,254	F320Y	possibly damaging	Het
Zscan4f	G	T	7: 11,401,278	G204*	probably null	Het

Other mutations in Rnf216

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02417:Rnf216	APN	5	143068910	missense	possibly damaging	0.67
IGL02502:Rnf216	APN	5	143068867	missense	probably damaging	1.00
IGL02536:Rnf216	APN	5	143080240	missense	probably benign	0.04
IGL03196:Rnf216	APN	5	143081011	missense	probably damaging	1.00
PIT4445001:Rnf216	UTSW	5	143086003	missense	probably damaging	1.00
R0270:Rnf216	UTSW	5	143080241	missense	possibly damaging	0.63
R0422:Rnf216	UTSW	5	143015654	nonsense	probably null
R0422:Rnf216	UTSW	5	143090370	missense	probably benign	0.15
R0782:Rnf216	UTSW	5	143068892	missense	possibly damaging	0.64
R1109:Rnf216	UTSW	5	143068369	missense	probably damaging	1.00
R1917:Rnf216	UTSW	5	142992806	missense	probably benign	0.03
R2233:Rnf216	UTSW	5	143090926	missense	probably benign
R2234:Rnf216	UTSW	5	143090926	missense	probably benign
R2235:Rnf216	UTSW	5	143090926	missense	probably benign
R2340:Rnf216	UTSW	5	143080334	missense	probably damaging	0.99
R3015:Rnf216	UTSW	5	143075725	critical splice donor site	probably null
R3726:Rnf216	UTSW	5	143027946	missense	probably damaging	0.96
R4231:Rnf216	UTSW	5	143093090	missense	probably damaging	1.00
R4885:Rnf216	UTSW	5	143090580	nonsense	probably null
R4942:Rnf216	UTSW	5	143093059	missense	probably damaging	1.00
R4973:Rnf216	UTSW	5	143090316	missense	probably benign
R5291:Rnf216	UTSW	5	143090212	missense	probably benign
R5307:Rnf216	UTSW	5	143093002	missense	probably damaging	1.00
R5328:Rnf216	UTSW	5	143092999	missense	possibly damaging	0.84
R5416:Rnf216	UTSW	5	143015771	nonsense	probably null
R5888:Rnf216	UTSW	5	143068314	splice site	probably null
R6048:Rnf216	UTSW	5	143068904	missense	probably damaging	1.00
R6451:Rnf216	UTSW	5	142992834	missense	possibly damaging	0.80
R6595:Rnf216	UTSW	5	143090657	missense	probably benign	0.00
R7422:Rnf216	UTSW	5	143090836	missense	probably benign	0.01
R7470:Rnf216	UTSW	5	142992725	missense	possibly damaging	0.88
R7504:Rnf216	UTSW	5	143075759	missense	probably benign	0.27
R7507:Rnf216	UTSW	5	143089802	missense	probably damaging	1.00
R7695:Rnf216	UTSW	5	143085904	missense	possibly damaging	0.80
R7768:Rnf216	UTSW	5	143098444	start codon destroyed	probably null	1.00
R8056:Rnf216	UTSW	5	142992861	missense	probably benign	0.02
R8081:Rnf216	UTSW	5	143027964	missense	probably damaging	0.98
R8985:Rnf216	UTSW	5	143090425	missense	probably benign	0.16
Z1176:Rnf216	UTSW	5	143098443	start codon destroyed	probably null	0.99
Z1177:Rnf216	UTSW	5	142992807	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AAAGCTGACATGTCATGGGAC -3'
(R):5'- TCCTAGTGAGTAGTTGTCCCTG -3'

Sequencing Primer
(F):5'- GTGTGGCCACAAATGTGC -3'
(R):5'- GAGTAGTTGTCCCTGTAATTTCAC -3'

Posted On

2019-11-26