Incidental Mutation 'R7758:Rbp3'
ID597694
Institutional Source Beutler Lab
Gene Symbol Rbp3
Ensembl Gene ENSMUSG00000041534
Gene Nameretinol binding protein 3, interstitial
SynonymsRbp-3, Irbp
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.720) question?
Stock #R7758 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location33954003-33964216 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 33954775 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 227 (V227M)
Ref Sequence ENSEMBL: ENSMUSP00000040249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035695]
Predicted Effect probably benign
Transcript: ENSMUST00000035695
AA Change: V227M

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000040249
Gene: ENSMUSG00000041534
AA Change: V227M

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
TSPc 109 308 5.72e-69 SMART
TSPc 416 616 1.98e-63 SMART
TSPc 720 917 5.34e-69 SMART
TSPc 1019 1216 2.13e-68 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interphotoreceptor retinol-binding protein is a large glycoprotein known to bind retinoids and found primarily in the interphotoreceptor matrix of the retina between the retinal pigment epithelium and the photoreceptor cells. It is thought to transport retinoids between the retinal pigment epithelium and the photoreceptors, a critical role in the visual process.The human IRBP gene is approximately 9.5 kbp in length and consists of four exons separated by three introns. The introns are 1.6-1.9 kbp long. The gene is transcribed by photoreceptor and retinoblastoma cells into an approximately 4.3-kilobase mRNA that is translated and processed into a glycosylated protein of 135,000 Da. The amino acid sequence of human IRBP can be divided into four contiguous homology domains with 33-38% identity, suggesting a series of gene duplication events. In the gene, the boundaries of these domains are not defined by exon-intron junctions, as might have been expected. The first three homology domains and part of the fourth are all encoded by the first large exon, which is 3,180 base pairs long. The remainder of the fourth domain is encoded in the last three exons, which are 191, 143, and approximately 740 base pairs long, respectively. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene experience photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,128,167 D1124G probably damaging Het
Actr10 A G 12: 70,942,326 H73R probably damaging Het
Ak9 G T 10: 41,347,132 A424S Het
Alkbh5 G A 11: 60,539,077 V219M probably damaging Het
Ankrd60 T C 2: 173,568,769 *319W probably null Het
Bfar T C 16: 13,702,121 F406S possibly damaging Het
Brd4 A G 17: 32,198,982 I1157T unknown Het
Card6 G A 15: 5,099,896 Q673* probably null Het
Cdyl T A 13: 35,872,641 Y585N probably damaging Het
Cep192 A C 18: 67,856,313 I1844L possibly damaging Het
Colec11 A C 12: 28,595,242 probably null Het
Crh T A 3: 19,694,289 Y63F probably damaging Het
Dmbt1 C T 7: 131,121,197 H1946Y unknown Het
Dock4 C T 12: 40,710,879 T522I probably benign Het
Fstl4 C A 11: 53,168,296 D527E possibly damaging Het
Gm17019 A G 5: 15,029,286 *256Q probably null Het
Gm5460 A T 14: 34,035,157 T64S probably benign Het
Hist2h3b A G 3: 96,268,887 K65R possibly damaging Het
Hoxa9 A T 6: 52,225,562 N181K probably benign Het
Ift81 A T 5: 122,551,025 L676H probably damaging Het
Klhl35 C T 7: 99,473,218 T87I unknown Het
Kmt2e A G 5: 23,496,070 T761A possibly damaging Het
Lca5l C T 16: 96,178,837 R36H probably benign Het
Lin7c T A 2: 109,896,372 I122K probably damaging Het
Malt1 A G 18: 65,473,119 I622V probably benign Het
Megf8 T C 7: 25,342,425 probably null Het
Morc2b A G 17: 33,137,007 V597A probably damaging Het
Olfr1225 T A 2: 89,171,141 I24L probably benign Het
Olfr229 T G 9: 39,910,325 I174S possibly damaging Het
Olfr963 T C 9: 39,669,075 M6T probably benign Het
Pdlim1 G A 19: 40,243,542 P131S probably benign Het
Plekhh1 T C 12: 79,070,804 I858T probably benign Het
Pls1 T C 9: 95,776,844 N197S probably benign Het
Pnmal1 A T 7: 16,961,299 T360S probably benign Het
Pon1 A T 6: 5,168,344 D354E probably benign Het
Prss43 G A 9: 110,829,391 G253E possibly damaging Het
Slc22a15 A G 3: 101,897,935 probably null Het
Slc7a11 A G 3: 50,372,360 I484T probably benign Het
Snrpa A G 7: 27,192,946 V63A possibly damaging Het
Sphk1 A G 11: 116,536,237 R340G possibly damaging Het
Strc T C 2: 121,370,946 E1259G probably benign Het
Suds3 T G 5: 117,115,737 D26A unknown Het
Taok3 A G 5: 117,250,907 E459G probably damaging Het
Unc13b CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,312 probably benign Het
Unc13b AGCCAG AGCCAGCGCCAG 4: 43,177,344 probably benign Het
Vmn1r201 A G 13: 22,474,819 T68A not run Het
Wdr59 T A 8: 111,480,485 I534F Het
Ylpm1 A G 12: 85,015,022 I566V unknown Het
Zbtb4 A G 11: 69,778,542 E697G probably benign Het
Zcchc14 T C 8: 121,604,689 K645R unknown Het
Zfp704 C T 3: 9,444,222 V388M possibly damaging Het
Zfp994 T C 17: 22,200,847 T374A possibly damaging Het
Other mutations in Rbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Rbp3 APN 14 33954188 missense possibly damaging 0.82
IGL01643:Rbp3 APN 14 33956836 missense probably benign 0.18
IGL01665:Rbp3 APN 14 33956131 missense probably benign 0.02
IGL01809:Rbp3 APN 14 33955300 missense probably damaging 1.00
IGL01975:Rbp3 APN 14 33958645 missense probably damaging 1.00
IGL02349:Rbp3 APN 14 33955719 missense probably damaging 0.97
IGL02447:Rbp3 APN 14 33954503 missense probably damaging 1.00
IGL03192:Rbp3 APN 14 33958583 missense possibly damaging 0.52
IGL03302:Rbp3 APN 14 33954659 missense probably damaging 0.97
Behagt UTSW 14 33954454 missense probably benign 0.00
jagt UTSW 14 33956482 missense probably damaging 0.97
muntre UTSW 14 33956356 missense possibly damaging 0.95
Rotwild UTSW 14 33956018 missense probably damaging 1.00
P4717OSA:Rbp3 UTSW 14 33955499 missense probably damaging 0.96
R0234:Rbp3 UTSW 14 33955901 missense probably damaging 0.98
R0234:Rbp3 UTSW 14 33955901 missense probably damaging 0.98
R0432:Rbp3 UTSW 14 33954773 missense probably damaging 1.00
R0469:Rbp3 UTSW 14 33962419 missense possibly damaging 0.95
R0652:Rbp3 UTSW 14 33958648 missense possibly damaging 0.89
R0739:Rbp3 UTSW 14 33958647 missense probably benign 0.28
R0747:Rbp3 UTSW 14 33956278 missense possibly damaging 0.51
R0836:Rbp3 UTSW 14 33956638 missense possibly damaging 0.84
R1102:Rbp3 UTSW 14 33956356 missense possibly damaging 0.95
R1583:Rbp3 UTSW 14 33954524 missense possibly damaging 0.45
R1589:Rbp3 UTSW 14 33955792 missense probably damaging 0.99
R1595:Rbp3 UTSW 14 33956198 missense possibly damaging 0.93
R1720:Rbp3 UTSW 14 33956909 missense probably benign 0.38
R1830:Rbp3 UTSW 14 33954644 missense probably benign 0.31
R1982:Rbp3 UTSW 14 33954545 missense probably damaging 0.99
R1985:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R1985:Rbp3 UTSW 14 33956461 missense probably benign 0.00
R2007:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2027:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2100:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2101:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2113:Rbp3 UTSW 14 33956057 missense probably benign 0.00
R2138:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2183:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2248:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2277:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2306:Rbp3 UTSW 14 33962563 missense probably damaging 1.00
R2504:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2696:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2697:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2698:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2920:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2940:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2971:Rbp3 UTSW 14 33954454 missense probably benign 0.00
R3111:Rbp3 UTSW 14 33954112 missense probably benign 0.01
R3155:Rbp3 UTSW 14 33957114 missense probably damaging 0.98
R3156:Rbp3 UTSW 14 33957114 missense probably damaging 0.98
R3751:Rbp3 UTSW 14 33956012 missense probably damaging 0.98
R3752:Rbp3 UTSW 14 33956012 missense probably damaging 0.98
R3851:Rbp3 UTSW 14 33955507 missense probably damaging 0.98
R4016:Rbp3 UTSW 14 33955390 missense possibly damaging 0.82
R4276:Rbp3 UTSW 14 33958650 missense probably benign 0.24
R4277:Rbp3 UTSW 14 33958650 missense probably benign 0.24
R4278:Rbp3 UTSW 14 33958650 missense probably benign 0.24
R4382:Rbp3 UTSW 14 33955296 missense probably benign 0.12
R4383:Rbp3 UTSW 14 33955296 missense probably benign 0.12
R4385:Rbp3 UTSW 14 33955296 missense probably benign 0.12
R4625:Rbp3 UTSW 14 33956099 missense probably benign
R4712:Rbp3 UTSW 14 33960658 missense probably damaging 0.97
R4812:Rbp3 UTSW 14 33954774 missense probably damaging 0.99
R4918:Rbp3 UTSW 14 33955411 missense probably damaging 1.00
R4971:Rbp3 UTSW 14 33954470 missense probably damaging 0.98
R5262:Rbp3 UTSW 14 33954850 missense probably damaging 1.00
R5387:Rbp3 UTSW 14 33956413 missense possibly damaging 0.95
R5468:Rbp3 UTSW 14 33956627 missense possibly damaging 0.93
R5837:Rbp3 UTSW 14 33954273 missense probably benign 0.00
R5994:Rbp3 UTSW 14 33954900 missense probably damaging 1.00
R6010:Rbp3 UTSW 14 33954647 missense probably damaging 1.00
R6041:Rbp3 UTSW 14 33956482 missense probably damaging 0.97
R6266:Rbp3 UTSW 14 33954461 missense probably benign
R6357:Rbp3 UTSW 14 33957034 missense probably damaging 0.99
R6457:Rbp3 UTSW 14 33955267 nonsense probably null
R6777:Rbp3 UTSW 14 33954273 missense probably benign 0.00
R7158:Rbp3 UTSW 14 33955556 missense probably benign 0.00
R7183:Rbp3 UTSW 14 33955204 missense probably benign 0.02
R7256:Rbp3 UTSW 14 33962583 missense possibly damaging 0.93
R7654:Rbp3 UTSW 14 33955840 missense probably benign
R7756:Rbp3 UTSW 14 33954775 missense probably benign 0.15
R7784:Rbp3 UTSW 14 33954158 missense probably benign 0.41
R7845:Rbp3 UTSW 14 33956464 missense probably benign 0.24
R8176:Rbp3 UTSW 14 33955648 missense possibly damaging 0.67
R8281:Rbp3 UTSW 14 33956363 missense probably benign 0.00
R8393:Rbp3 UTSW 14 33956199 missense possibly damaging 0.93
Z1177:Rbp3 UTSW 14 33954538 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TCCTTGGTGCTAGATCTCCG -3'
(R):5'- TTCTAGGGCTTGCTCTGCAG -3'

Sequencing Primer
(F):5'- TGCTAGATCTCCGGCACTG -3'
(R):5'- TCTGGCCACCTCCACCTAGAG -3'
Posted On2019-11-26