Incidental Mutation 'R4712:Rbp3'
ID353323
Institutional Source Beutler Lab
Gene Symbol Rbp3
Ensembl Gene ENSMUSG00000041534
Gene Nameretinol binding protein 3, interstitial
SynonymsRbp-3, Irbp
MMRRC Submission 041981-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.559) question?
Stock #R4712 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location33954003-33964216 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33960658 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1116 (S1116P)
Ref Sequence ENSEMBL: ENSMUSP00000040249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035695]
Predicted Effect probably damaging
Transcript: ENSMUST00000035695
AA Change: S1116P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000040249
Gene: ENSMUSG00000041534
AA Change: S1116P

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
TSPc 109 308 5.72e-69 SMART
TSPc 416 616 1.98e-63 SMART
TSPc 720 917 5.34e-69 SMART
TSPc 1019 1216 2.13e-68 SMART
Meta Mutation Damage Score 0.3042 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interphotoreceptor retinol-binding protein is a large glycoprotein known to bind retinoids and found primarily in the interphotoreceptor matrix of the retina between the retinal pigment epithelium and the photoreceptor cells. It is thought to transport retinoids between the retinal pigment epithelium and the photoreceptors, a critical role in the visual process.The human IRBP gene is approximately 9.5 kbp in length and consists of four exons separated by three introns. The introns are 1.6-1.9 kbp long. The gene is transcribed by photoreceptor and retinoblastoma cells into an approximately 4.3-kilobase mRNA that is translated and processed into a glycosylated protein of 135,000 Da. The amino acid sequence of human IRBP can be divided into four contiguous homology domains with 33-38% identity, suggesting a series of gene duplication events. In the gene, the boundaries of these domains are not defined by exon-intron junctions, as might have been expected. The first three homology domains and part of the fourth are all encoded by the first large exon, which is 3,180 base pairs long. The remainder of the fourth domain is encoded in the last three exons, which are 191, 143, and approximately 740 base pairs long, respectively. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene experience photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik G A 13: 58,381,803 R332C probably benign Het
2900055J20Rik G T 18: 40,257,180 probably benign Het
A4galt G T 15: 83,227,609 N324K probably damaging Het
Ahcyl1 A G 3: 107,667,231 probably benign Het
Atrnl1 T A 19: 57,652,950 N343K probably benign Het
Batf2 C A 19: 6,171,327 Q56K probably benign Het
Cfh A T 1: 140,108,536 V691D probably damaging Het
Chst10 T C 1: 38,865,841 Y257C probably damaging Het
Dlg5 A T 14: 24,177,983 L290Q possibly damaging Het
Dnah2 T A 11: 69,516,590 T456S possibly damaging Het
Dnah6 T C 6: 73,025,012 probably null Het
Efhb T C 17: 53,451,669 K313R probably damaging Het
Eprs T A 1: 185,428,108 N1500K probably benign Het
Fbn1 T C 2: 125,341,316 T1748A probably benign Het
Gfra2 T A 14: 70,925,937 L87H probably damaging Het
Gfral T A 9: 76,193,445 Y237F possibly damaging Het
Gpr137b T C 13: 13,359,389 N361D probably benign Het
Gsdmc G T 15: 63,779,537 T272N probably benign Het
Hspe1 T A 1: 55,089,110 S21R probably benign Het
Kif21a A T 15: 90,984,755 I483N probably damaging Het
Kif4-ps T C 12: 101,146,275 noncoding transcript Het
Lpp T C 16: 24,761,657 V166A possibly damaging Het
Lrp2 A C 2: 69,506,551 D1292E probably damaging Het
Manba T C 3: 135,544,814 Y401H probably damaging Het
Msh2 T G 17: 87,678,385 probably benign Het
Myef2 A T 2: 125,088,837 probably benign Het
Ncor1 T A 11: 62,344,834 Q598L probably damaging Het
Obox3 A G 7: 15,626,839 V125A probably benign Het
Olfr124 T A 17: 37,805,700 L185* probably null Het
Olfr351 A T 2: 36,860,369 probably null Het
Olfr827 G A 10: 130,210,422 T236I possibly damaging Het
Pcdh9 C A 14: 93,888,631 L34F probably damaging Het
Pcdha3 A T 18: 36,946,507 I101F probably damaging Het
Pced1b A G 15: 97,384,794 E238G probably benign Het
Pla2r1 A T 2: 60,428,650 N1131K probably damaging Het
Prmt1 A T 7: 44,981,636 S99R probably damaging Het
Rhobtb2 T C 14: 69,799,711 D88G probably damaging Het
Rngtt A G 4: 33,379,394 E432G probably benign Het
Sh3rf1 A G 8: 61,361,759 T451A probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Siva1 T A 12: 112,646,902 D61E probably benign Het
Skor1 A C 9: 63,139,573 probably null Het
Slc20a1 A G 2: 129,199,691 probably benign Het
Slc2a7 A G 4: 150,168,469 E522G probably benign Het
Tmprss7 A T 16: 45,690,760 I85N probably damaging Het
Tpx2 T A 2: 152,885,038 D408E probably damaging Het
Ulk4 A T 9: 121,244,370 I551N probably benign Het
Zfat A T 15: 68,110,475 probably null Het
Zfp101 C A 17: 33,394,483 probably null Het
Other mutations in Rbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Rbp3 APN 14 33954188 missense possibly damaging 0.82
IGL01643:Rbp3 APN 14 33956836 missense probably benign 0.18
IGL01665:Rbp3 APN 14 33956131 missense probably benign 0.02
IGL01809:Rbp3 APN 14 33955300 missense probably damaging 1.00
IGL01975:Rbp3 APN 14 33958645 missense probably damaging 1.00
IGL02349:Rbp3 APN 14 33955719 missense probably damaging 0.97
IGL02447:Rbp3 APN 14 33954503 missense probably damaging 1.00
IGL03192:Rbp3 APN 14 33958583 missense possibly damaging 0.52
IGL03302:Rbp3 APN 14 33954659 missense probably damaging 0.97
Behagt UTSW 14 33954454 missense probably benign 0.00
jagt UTSW 14 33956482 missense probably damaging 0.97
muntre UTSW 14 33956356 missense possibly damaging 0.95
Rotwild UTSW 14 33956018 missense probably damaging 1.00
P4717OSA:Rbp3 UTSW 14 33955499 missense probably damaging 0.96
R0234:Rbp3 UTSW 14 33955901 missense probably damaging 0.98
R0234:Rbp3 UTSW 14 33955901 missense probably damaging 0.98
R0432:Rbp3 UTSW 14 33954773 missense probably damaging 1.00
R0469:Rbp3 UTSW 14 33962419 missense possibly damaging 0.95
R0652:Rbp3 UTSW 14 33958648 missense possibly damaging 0.89
R0739:Rbp3 UTSW 14 33958647 missense probably benign 0.28
R0747:Rbp3 UTSW 14 33956278 missense possibly damaging 0.51
R0836:Rbp3 UTSW 14 33956638 missense possibly damaging 0.84
R1102:Rbp3 UTSW 14 33956356 missense possibly damaging 0.95
R1583:Rbp3 UTSW 14 33954524 missense possibly damaging 0.45
R1589:Rbp3 UTSW 14 33955792 missense probably damaging 0.99
R1595:Rbp3 UTSW 14 33956198 missense possibly damaging 0.93
R1720:Rbp3 UTSW 14 33956909 missense probably benign 0.38
R1830:Rbp3 UTSW 14 33954644 missense probably benign 0.31
R1982:Rbp3 UTSW 14 33954545 missense probably damaging 0.99
R1985:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R1985:Rbp3 UTSW 14 33956461 missense probably benign 0.00
R2007:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2027:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2100:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2101:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2113:Rbp3 UTSW 14 33956057 missense probably benign 0.00
R2138:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2183:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2248:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2277:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2306:Rbp3 UTSW 14 33962563 missense probably damaging 1.00
R2504:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2696:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2697:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2698:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2920:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2940:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2971:Rbp3 UTSW 14 33954454 missense probably benign 0.00
R3111:Rbp3 UTSW 14 33954112 missense probably benign 0.01
R3155:Rbp3 UTSW 14 33957114 missense probably damaging 0.98
R3156:Rbp3 UTSW 14 33957114 missense probably damaging 0.98
R3751:Rbp3 UTSW 14 33956012 missense probably damaging 0.98
R3752:Rbp3 UTSW 14 33956012 missense probably damaging 0.98
R3851:Rbp3 UTSW 14 33955507 missense probably damaging 0.98
R4016:Rbp3 UTSW 14 33955390 missense possibly damaging 0.82
R4276:Rbp3 UTSW 14 33958650 missense probably benign 0.24
R4277:Rbp3 UTSW 14 33958650 missense probably benign 0.24
R4278:Rbp3 UTSW 14 33958650 missense probably benign 0.24
R4382:Rbp3 UTSW 14 33955296 missense probably benign 0.12
R4383:Rbp3 UTSW 14 33955296 missense probably benign 0.12
R4385:Rbp3 UTSW 14 33955296 missense probably benign 0.12
R4625:Rbp3 UTSW 14 33956099 missense probably benign
R4812:Rbp3 UTSW 14 33954774 missense probably damaging 0.99
R4918:Rbp3 UTSW 14 33955411 missense probably damaging 1.00
R4971:Rbp3 UTSW 14 33954470 missense probably damaging 0.98
R5262:Rbp3 UTSW 14 33954850 missense probably damaging 1.00
R5387:Rbp3 UTSW 14 33956413 missense possibly damaging 0.95
R5468:Rbp3 UTSW 14 33956627 missense possibly damaging 0.93
R5837:Rbp3 UTSW 14 33954273 missense probably benign 0.00
R5994:Rbp3 UTSW 14 33954900 missense probably damaging 1.00
R6010:Rbp3 UTSW 14 33954647 missense probably damaging 1.00
R6041:Rbp3 UTSW 14 33956482 missense probably damaging 0.97
R6266:Rbp3 UTSW 14 33954461 missense probably benign
R6357:Rbp3 UTSW 14 33957034 missense probably damaging 0.99
R6457:Rbp3 UTSW 14 33955267 nonsense probably null
R6777:Rbp3 UTSW 14 33954273 missense probably benign 0.00
R7158:Rbp3 UTSW 14 33955556 missense probably benign 0.00
R7183:Rbp3 UTSW 14 33955204 missense probably benign 0.02
R7256:Rbp3 UTSW 14 33962583 missense possibly damaging 0.93
R7654:Rbp3 UTSW 14 33955840 missense probably benign
R7756:Rbp3 UTSW 14 33954775 missense probably benign 0.15
R7758:Rbp3 UTSW 14 33954775 missense probably benign 0.15
R7784:Rbp3 UTSW 14 33954158 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- TCTTCACAGGACAAAGAGCC -3'
(R):5'- GATACTGAAGGTTGTTCCAGGACTG -3'

Sequencing Primer
(F):5'- TTCACAGGACAAAGAGCCAAGTTC -3'
(R):5'- ACTCAAGCTGTTTTTCTCTG -3'
Posted On2015-10-21