Mutagenetix > Incidental Mutation

Incidental Mutation 'R7772:Heatr1'

598659

Institutional Source

Beutler Lab

Gene Symbol

Heatr1

Ensembl Gene

ENSMUSG00000050244

Gene Name

HEAT repeat containing 1

Synonyms

B130016L12Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.970) question?

Stock #

R7772 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

12395027-12440289 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 12417641 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 1089 (M1089T)

Ref Sequence

ENSEMBL: ENSMUSP00000054084 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059270]

AlphaFold

G3X9B1

Predicted Effect

probably benign
Transcript: ENSMUST00000059270
AA Change: M1089T

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000054084
Gene: ENSMUSG00000050244
AA Change: M1089T

Domain	Start	End	E-Value	Type
low complexity region	4	15	N/A	INTRINSIC
Pfam:U3snoRNP10	238	354	7e-30	PFAM
SCOP:d1qbkb_	919	1795	3e-8	SMART
low complexity region	1805	1814	N/A	INTRINSIC
BP28CT	1856	2009	2.25e-77	SMART
Blast:BP28CT	2015	2061	2e-15	BLAST
coiled coil region	2109	2137	N/A	INTRINSIC

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

99% (68/69)

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921536K21Rik	T	A	11: 3,889,784		probably null	Het
Adora3	T	C	3: 105,907,723	V263A	probably benign	Het
Adprhl1	C	T	8: 13,248,682	V83I	probably damaging	Het
Arfgef1	A	G	1: 10,157,010	V1368A	possibly damaging	Het
Arid4a	A	T	12: 71,061,589	N56I	possibly damaging	Het
Art3	A	T	5: 92,403,613	Y277F	probably damaging	Het
Atp2a1	A	T	7: 126,448,535		probably null	Het
Banf1	T	C	19: 5,365,122	K54E	possibly damaging	Het
Bckdk	A	G	7: 127,905,901	Y151C	probably damaging	Het
C1qtnf3	C	A	15: 10,958,044	P58T	possibly damaging	Het
Cadps2	T	C	6: 23,390,446	R744G	probably benign	Het
Cdc25b	A	G	2: 131,189,109	D118G	probably damaging	Het
Cnot9	G	A	1: 74,526,992	V181I	probably damaging	Het
Cobl	C	T	11: 12,254,488	G738D	probably benign	Het
Col18a1	T	A	10: 77,068,386		probably null	Het
Crnkl1	A	G	2: 145,930,644	V171A	probably benign	Het
Dhx57	C	T	17: 80,273,078	D482N	possibly damaging	Het
Dpysl2	A	T	14: 66,828,976		probably null	Het
Drd3	G	T	16: 43,762,395	A52S	probably benign	Het
Dst	T	C	1: 34,181,388	V2091A	possibly damaging	Het
Evpl	T	C	11: 116,221,435	T1810A	probably benign	Het
Fbxo2	T	A	4: 148,164,326	W92R	probably damaging	Het
Gas2l2	T	A	11: 83,429,277	D51V	possibly damaging	Het
Gm11232	A	T	4: 71,756,581	V228E	possibly damaging	Het
Gm14305	C	T	2: 176,720,971	Q219*	probably null	Het
Gpr137b	T	C	13: 13,359,406	Y355C		Het
Gpr39	G	T	1: 125,677,597	M87I	possibly damaging	Het
Ifi206	A	T	1: 173,481,074	M452K		Het
Ints8	A	T	4: 11,227,190	I561N	probably damaging	Het
Itgb2	A	T	10: 77,561,112	K660N	probably benign	Het
Jun	A	C	4: 95,050,844	V143G	probably benign	Het
Kalrn	A	G	16: 34,031,582	M2076T	probably benign	Het
Krt10	G	T	11: 99,389,087	S82R	unknown	Het
Lipm	T	A	19: 34,117,891	H295Q	probably damaging	Het
Mybpc2	A	C	7: 44,515,924		probably null	Het
Nedd4	T	C	9: 72,677,326	V103A	possibly damaging	Het
Nol10	T	C	12: 17,348,585	I11T	probably damaging	Het
Nup210l	A	G	3: 90,159,926	S758G	probably damaging	Het
Olfr270	T	A	4: 52,970,713	C31S	probably damaging	Het
Olfr584	T	G	7: 103,086,181	I216S	probably benign	Het
Olfr985	T	C	9: 40,127,365	I199V	probably benign	Het
Osbpl9	T	C	4: 109,066,187	H425R	probably damaging	Het
Parp1	G	T	1: 180,589,398	R582S	possibly damaging	Het
Piwil1	A	T	5: 128,739,463	R36S	probably benign	Het
Pjvk	T	C	2: 76,657,533		probably null	Het
Plekha6	G	T	1: 133,170,022	E31D	possibly damaging	Het
Polr1b	C	A	2: 129,125,544	F952L	probably damaging	Het
Prm3	CTCTTCTTCTTCTTC	CTCTTCTTCTTC	16: 10,790,701		probably benign	Het
Psmc6	T	A	14: 45,343,650	I301N	probably damaging	Het
Rfpl4	C	A	7: 5,115,544	S9I	probably benign	Het
Rnf14	G	T	18: 38,309,576	C310F	probably damaging	Het
Rnf17	T	A	14: 56,477,687	F845L	probably benign	Het
Robo2	T	C	16: 73,961,889	I665V	probably benign	Het
Rtl1	T	A	12: 109,593,185	H740L	probably damaging	Het
Ryr2	A	G	13: 11,751,011	S1280P	probably benign	Het
Slc12a8	G	A	16: 33,550,965	R126H	probably damaging	Het
Slc9a1	T	C	4: 133,411,965	F165L	probably damaging	Het
Snx19	T	C	9: 30,428,925	I453T	probably damaging	Het
Spag17	T	C	3: 100,080,118	Y1575H	probably damaging	Het
Spef2	T	C	15: 9,704,481	I415M	probably damaging	Het
Ssx2ip	T	G	3: 146,433,130	I459S	probably damaging	Het
Stfa1	A	G	16: 36,277,001		probably null	Het
Tmem156	A	T	5: 65,080,174	S48T	probably damaging	Het
Tmx3	T	A	18: 90,527,794		probably null	Het
Unc93a	A	T	17: 13,109,752	F405I	possibly damaging	Het
Vmn1r209	T	A	13: 22,806,494	I9F	possibly damaging	Het
Vmn2r93	A	G	17: 18,313,220	D462G	probably damaging	Het
Wdr90	T	A	17: 25,861,491		probably benign	Het
Zfp551	T	C	7: 12,418,608	D66G	probably damaging	Het
Znrf4	A	C	17: 56,512,247	V20G	possibly damaging	Het
Zscan4d	T	C	7: 11,162,843	E200G	probably benign	Het
Zufsp	A	T	10: 33,921,702		probably null	Het

Other mutations in Heatr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00666:Heatr1	APN	13	12410450	missense	probably benign	0.00
IGL00863:Heatr1	APN	13	12435128	missense	probably benign	0.02
IGL00899:Heatr1	APN	13	12435176	missense	probably benign	0.31
IGL01147:Heatr1	APN	13	12437912	missense	probably damaging	0.99
IGL01317:Heatr1	APN	13	12399027	missense	probably damaging	1.00
IGL01323:Heatr1	APN	13	12398938	missense	possibly damaging	0.86
IGL01625:Heatr1	APN	13	12413528	missense	probably damaging	0.98
IGL01973:Heatr1	APN	13	12429799	missense	probably benign
IGL02803:Heatr1	APN	13	12433986	missense	probably damaging	0.96
IGL02830:Heatr1	APN	13	12426212	missense	possibly damaging	0.57
IGL02956:Heatr1	APN	13	12416059	missense	possibly damaging	0.53
IGL03000:Heatr1	APN	13	12434411	missense	probably damaging	0.99
IGL03024:Heatr1	APN	13	12407509	unclassified	probably benign
IGL03035:Heatr1	APN	13	12413219	splice site	probably benign
IGL03301:Heatr1	APN	13	12434205	missense	probably damaging	1.00
hasan	UTSW	13	12417447	splice site	probably benign
H8562:Heatr1	UTSW	13	12408713	missense	probably benign	0.13
R0226:Heatr1	UTSW	13	12410562	missense	probably damaging	1.00
R0571:Heatr1	UTSW	13	12430240	missense	probably damaging	0.98
R0722:Heatr1	UTSW	13	12406037	missense	probably benign	0.14
R1264:Heatr1	UTSW	13	12424610	unclassified	probably benign
R1371:Heatr1	UTSW	13	12417632	missense	possibly damaging	0.80
R1388:Heatr1	UTSW	13	12417447	splice site	probably benign
R1396:Heatr1	UTSW	13	12406046	missense	possibly damaging	0.86
R1519:Heatr1	UTSW	13	12412159	missense	probably benign
R1689:Heatr1	UTSW	13	12424625	missense	probably benign	0.00
R1696:Heatr1	UTSW	13	12423721	missense	possibly damaging	0.96
R1756:Heatr1	UTSW	13	12396460	missense	probably benign	0.01
R1859:Heatr1	UTSW	13	12403159	missense	probably damaging	1.00
R1932:Heatr1	UTSW	13	12435185	missense	probably damaging	1.00
R1957:Heatr1	UTSW	13	12396538	missense	probably damaging	1.00
R2018:Heatr1	UTSW	13	12414478	missense	possibly damaging	0.68
R2106:Heatr1	UTSW	13	12412058	missense	probably benign	0.03
R2119:Heatr1	UTSW	13	12432646	missense	probably null	1.00
R2121:Heatr1	UTSW	13	12403264	missense	probably benign	0.10
R2122:Heatr1	UTSW	13	12403264	missense	probably benign	0.10
R2367:Heatr1	UTSW	13	12433724	missense	probably damaging	1.00
R3777:Heatr1	UTSW	13	12413348	missense	possibly damaging	0.92
R3783:Heatr1	UTSW	13	12434460	missense	probably damaging	1.00
R3784:Heatr1	UTSW	13	12434460	missense	probably damaging	1.00
R3786:Heatr1	UTSW	13	12434460	missense	probably damaging	1.00
R3787:Heatr1	UTSW	13	12434460	missense	probably damaging	1.00
R3843:Heatr1	UTSW	13	12435121	missense	probably benign	0.00
R4533:Heatr1	UTSW	13	12434511	missense	probably benign	0.05
R4725:Heatr1	UTSW	13	12424662	nonsense	probably null
R4763:Heatr1	UTSW	13	12430930	missense	possibly damaging	0.65
R4793:Heatr1	UTSW	13	12431837	missense	probably benign	0.00
R4797:Heatr1	UTSW	13	12412048	missense	probably benign	0.36
R4798:Heatr1	UTSW	13	12412048	missense	probably benign	0.36
R4942:Heatr1	UTSW	13	12413510	critical splice acceptor site	probably null
R4952:Heatr1	UTSW	13	12410599	missense	probably benign	0.38
R4954:Heatr1	UTSW	13	12407516	critical splice acceptor site	probably null
R5370:Heatr1	UTSW	13	12401522	missense	probably benign	0.02
R5464:Heatr1	UTSW	13	12433643	missense	probably benign	0.00
R5483:Heatr1	UTSW	13	12398914	missense	probably damaging	1.00
R5497:Heatr1	UTSW	13	12421064	missense	possibly damaging	0.93
R5504:Heatr1	UTSW	13	12406619	missense	possibly damaging	0.64
R5527:Heatr1	UTSW	13	12402760	missense	probably damaging	1.00
R5527:Heatr1	UTSW	13	12404948	missense	probably benign
R5836:Heatr1	UTSW	13	12408736	missense	probably damaging	0.99
R5916:Heatr1	UTSW	13	12434471	missense	probably damaging	1.00
R6018:Heatr1	UTSW	13	12404947	missense	probably benign
R6018:Heatr1	UTSW	13	12406058	missense	probably benign	0.26
R6216:Heatr1	UTSW	13	12432664	missense	probably benign	0.16
R6396:Heatr1	UTSW	13	12406097	missense	possibly damaging	0.86
R6472:Heatr1	UTSW	13	12434230	missense	probably benign	0.29
R6922:Heatr1	UTSW	13	12435075	missense	probably benign	0.00
R7077:Heatr1	UTSW	13	12418164	missense	possibly damaging	0.63
R7297:Heatr1	UTSW	13	12421060	nonsense	probably null
R7445:Heatr1	UTSW	13	12431038	missense	possibly damaging	0.70
R7669:Heatr1	UTSW	13	12411262	missense	probably benign	0.33
R7672:Heatr1	UTSW	13	12438664	missense	probably damaging	0.96
R8205:Heatr1	UTSW	13	12416047	missense	probably benign
R8518:Heatr1	UTSW	13	12410534	missense	probably benign
R8754:Heatr1	UTSW	13	12413294	missense	probably damaging	0.99
R8874:Heatr1	UTSW	13	12430912	missense	probably damaging	1.00
R8992:Heatr1	UTSW	13	12401114	missense	probably damaging	0.98
R9045:Heatr1	UTSW	13	12413352	missense	probably benign	0.00
R9077:Heatr1	UTSW	13	12413366	missense	probably benign
R9183:Heatr1	UTSW	13	12421385	missense	probably damaging	0.99
R9186:Heatr1	UTSW	13	12421346	missense	probably damaging	1.00
R9223:Heatr1	UTSW	13	12404921	missense	probably benign	0.00
R9242:Heatr1	UTSW	13	12433925	missense	probably benign
R9267:Heatr1	UTSW	13	12406608	missense	probably damaging	1.00
R9289:Heatr1	UTSW	13	12432727	missense	probably benign	0.13
R9310:Heatr1	UTSW	13	12438610	missense	probably benign
R9312:Heatr1	UTSW	13	12431684	missense	probably benign
R9358:Heatr1	UTSW	13	12418206	missense	probably benign	0.09
R9385:Heatr1	UTSW	13	12406542	missense	probably damaging	1.00
R9530:Heatr1	UTSW	13	12424726	missense	probably damaging	1.00
R9532:Heatr1	UTSW	13	12414425	missense	possibly damaging	0.72
R9647:Heatr1	UTSW	13	12426798	missense	probably benign	0.00
R9683:Heatr1	UTSW	13	12434259	missense	probably damaging	1.00
R9695:Heatr1	UTSW	13	12423743	missense	probably damaging	1.00
RF011:Heatr1	UTSW	13	12407544	missense	probably benign	0.00
Z1176:Heatr1	UTSW	13	12399008	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- GCATGAGTCTGACAACCTTCTCTC -3'
(R):5'- GGCTTGCTGCAACTTTTGTAC -3'

Sequencing Primer
(F):5'- CTTTAGATGGTGCTTGCCCAG -3'
(R):5'- CTTGCTGCAACTTTTGTACAGTAG -3'

Posted On

2019-11-26