Incidental Mutation 'R7772:Heatr1'
ID598659
Institutional Source Beutler Lab
Gene Symbol Heatr1
Ensembl Gene ENSMUSG00000050244
Gene NameHEAT repeat containing 1
SynonymsB130016L12Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R7772 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location12395027-12440289 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12417641 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1089 (M1089T)
Ref Sequence ENSEMBL: ENSMUSP00000054084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059270]
Predicted Effect probably benign
Transcript: ENSMUST00000059270
AA Change: M1089T

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000054084
Gene: ENSMUSG00000050244
AA Change: M1089T

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:U3snoRNP10 238 354 7e-30 PFAM
SCOP:d1qbkb_ 919 1795 3e-8 SMART
low complexity region 1805 1814 N/A INTRINSIC
BP28CT 1856 2009 2.25e-77 SMART
Blast:BP28CT 2015 2061 2e-15 BLAST
coiled coil region 2109 2137 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adora3 T C 3: 105,907,723 V263A probably benign Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
Arfgef1 A G 1: 10,157,010 V1368A possibly damaging Het
Arid4a A T 12: 71,061,589 N56I possibly damaging Het
Art3 A T 5: 92,403,613 Y277F probably damaging Het
Atp2a1 A T 7: 126,448,535 probably null Het
Banf1 T C 19: 5,365,122 K54E possibly damaging Het
Bckdk A G 7: 127,905,901 Y151C probably damaging Het
C1qtnf3 C A 15: 10,958,044 P58T possibly damaging Het
Cadps2 T C 6: 23,390,446 R744G probably benign Het
Cdc25b A G 2: 131,189,109 D118G probably damaging Het
Cnot9 G A 1: 74,526,992 V181I probably damaging Het
Cobl C T 11: 12,254,488 G738D probably benign Het
Crnkl1 A G 2: 145,930,644 V171A probably benign Het
Dhx57 C T 17: 80,273,078 D482N possibly damaging Het
Drd3 G T 16: 43,762,395 A52S probably benign Het
Dst T C 1: 34,181,388 V2091A possibly damaging Het
Evpl T C 11: 116,221,435 T1810A probably benign Het
Fbxo2 T A 4: 148,164,326 W92R probably damaging Het
Gas2l2 T A 11: 83,429,277 D51V possibly damaging Het
Gm11232 A T 4: 71,756,581 V228E possibly damaging Het
Gm14305 C T 2: 176,720,971 Q219* probably null Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gpr39 G T 1: 125,677,597 M87I possibly damaging Het
Ifi206 A T 1: 173,481,074 M452K Het
Ints8 A T 4: 11,227,190 I561N probably damaging Het
Itgb2 A T 10: 77,561,112 K660N probably benign Het
Jun A C 4: 95,050,844 V143G probably benign Het
Kalrn A G 16: 34,031,582 M2076T probably benign Het
Krt10 G T 11: 99,389,087 S82R unknown Het
Lipm T A 19: 34,117,891 H295Q probably damaging Het
Mybpc2 A C 7: 44,515,924 probably null Het
Nedd4 T C 9: 72,677,326 V103A possibly damaging Het
Nol10 T C 12: 17,348,585 I11T probably damaging Het
Nup210l A G 3: 90,159,926 S758G probably damaging Het
Olfr270 T A 4: 52,970,713 C31S probably damaging Het
Olfr584 T G 7: 103,086,181 I216S probably benign Het
Olfr985 T C 9: 40,127,365 I199V probably benign Het
Osbpl9 T C 4: 109,066,187 H425R probably damaging Het
Parp1 G T 1: 180,589,398 R582S possibly damaging Het
Piwil1 A T 5: 128,739,463 R36S probably benign Het
Pjvk T C 2: 76,657,533 probably null Het
Plekha6 G T 1: 133,170,022 E31D possibly damaging Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Prm3 CTCTTCTTCTTCTTC CTCTTCTTCTTC 16: 10,790,701 probably benign Het
Psmc6 T A 14: 45,343,650 I301N probably damaging Het
Rfpl4 C A 7: 5,115,544 S9I probably benign Het
Rnf14 G T 18: 38,309,576 C310F probably damaging Het
Rnf17 T A 14: 56,477,687 F845L probably benign Het
Robo2 T C 16: 73,961,889 I665V probably benign Het
Rtl1 T A 12: 109,593,185 H740L probably damaging Het
Ryr2 A G 13: 11,751,011 S1280P probably benign Het
Slc12a8 G A 16: 33,550,965 R126H probably damaging Het
Slc9a1 T C 4: 133,411,965 F165L probably damaging Het
Snx19 T C 9: 30,428,925 I453T probably damaging Het
Spag17 T C 3: 100,080,118 Y1575H probably damaging Het
Spef2 T C 15: 9,704,481 I415M probably damaging Het
Ssx2ip T G 3: 146,433,130 I459S probably damaging Het
Tmem156 A T 5: 65,080,174 S48T probably damaging Het
Unc93a A T 17: 13,109,752 F405I possibly damaging Het
Vmn1r209 T A 13: 22,806,494 I9F possibly damaging Het
Vmn2r93 A G 17: 18,313,220 D462G probably damaging Het
Wdr90 T A 17: 25,861,491 probably benign Het
Zfp551 T C 7: 12,418,608 D66G probably damaging Het
Znrf4 A C 17: 56,512,247 V20G possibly damaging Het
Zscan4d T C 7: 11,162,843 E200G probably benign Het
Other mutations in Heatr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Heatr1 APN 13 12410450 missense probably benign 0.00
IGL00863:Heatr1 APN 13 12435128 missense probably benign 0.02
IGL00899:Heatr1 APN 13 12435176 missense probably benign 0.31
IGL01147:Heatr1 APN 13 12437912 missense probably damaging 0.99
IGL01317:Heatr1 APN 13 12399027 missense probably damaging 1.00
IGL01323:Heatr1 APN 13 12398938 missense possibly damaging 0.86
IGL01625:Heatr1 APN 13 12413528 missense probably damaging 0.98
IGL01973:Heatr1 APN 13 12429799 missense probably benign
IGL02803:Heatr1 APN 13 12433986 missense probably damaging 0.96
IGL02830:Heatr1 APN 13 12426212 missense possibly damaging 0.57
IGL02956:Heatr1 APN 13 12416059 missense possibly damaging 0.53
IGL03000:Heatr1 APN 13 12434411 missense probably damaging 0.99
IGL03024:Heatr1 APN 13 12407509 unclassified probably benign
IGL03035:Heatr1 APN 13 12413219 splice site probably benign
IGL03301:Heatr1 APN 13 12434205 missense probably damaging 1.00
hasan UTSW 13 12417447 splice site probably benign
H8562:Heatr1 UTSW 13 12408713 missense probably benign 0.13
R0226:Heatr1 UTSW 13 12410562 missense probably damaging 1.00
R0571:Heatr1 UTSW 13 12430240 missense probably damaging 0.98
R0722:Heatr1 UTSW 13 12406037 missense probably benign 0.14
R1264:Heatr1 UTSW 13 12424610 unclassified probably benign
R1371:Heatr1 UTSW 13 12417632 missense possibly damaging 0.80
R1388:Heatr1 UTSW 13 12417447 splice site probably benign
R1396:Heatr1 UTSW 13 12406046 missense possibly damaging 0.86
R1519:Heatr1 UTSW 13 12412159 missense probably benign
R1689:Heatr1 UTSW 13 12424625 missense probably benign 0.00
R1696:Heatr1 UTSW 13 12423721 missense possibly damaging 0.96
R1756:Heatr1 UTSW 13 12396460 missense probably benign 0.01
R1859:Heatr1 UTSW 13 12403159 missense probably damaging 1.00
R1932:Heatr1 UTSW 13 12435185 missense probably damaging 1.00
R1957:Heatr1 UTSW 13 12396538 missense probably damaging 1.00
R2018:Heatr1 UTSW 13 12414478 missense possibly damaging 0.68
R2106:Heatr1 UTSW 13 12412058 missense probably benign 0.03
R2119:Heatr1 UTSW 13 12432646 missense probably null 1.00
R2121:Heatr1 UTSW 13 12403264 missense probably benign 0.10
R2122:Heatr1 UTSW 13 12403264 missense probably benign 0.10
R2367:Heatr1 UTSW 13 12433724 missense probably damaging 1.00
R3777:Heatr1 UTSW 13 12413348 missense possibly damaging 0.92
R3783:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3784:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3786:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3787:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3843:Heatr1 UTSW 13 12435121 missense probably benign 0.00
R4533:Heatr1 UTSW 13 12434511 missense probably benign 0.05
R4725:Heatr1 UTSW 13 12424662 nonsense probably null
R4763:Heatr1 UTSW 13 12430930 missense possibly damaging 0.65
R4793:Heatr1 UTSW 13 12431837 missense probably benign 0.00
R4797:Heatr1 UTSW 13 12412048 missense probably benign 0.36
R4798:Heatr1 UTSW 13 12412048 missense probably benign 0.36
R4942:Heatr1 UTSW 13 12413510 critical splice acceptor site probably null
R4952:Heatr1 UTSW 13 12410599 missense probably benign 0.38
R4954:Heatr1 UTSW 13 12407516 critical splice acceptor site probably null
R5370:Heatr1 UTSW 13 12401522 missense probably benign 0.02
R5464:Heatr1 UTSW 13 12433643 missense probably benign 0.00
R5483:Heatr1 UTSW 13 12398914 missense probably damaging 1.00
R5497:Heatr1 UTSW 13 12421064 missense possibly damaging 0.93
R5504:Heatr1 UTSW 13 12406619 missense possibly damaging 0.64
R5527:Heatr1 UTSW 13 12402760 missense probably damaging 1.00
R5527:Heatr1 UTSW 13 12404948 missense probably benign
R5836:Heatr1 UTSW 13 12408736 missense probably damaging 0.99
R5916:Heatr1 UTSW 13 12434471 missense probably damaging 1.00
R6018:Heatr1 UTSW 13 12404947 missense probably benign
R6018:Heatr1 UTSW 13 12406058 missense probably benign 0.26
R6216:Heatr1 UTSW 13 12432664 missense probably benign 0.16
R6396:Heatr1 UTSW 13 12406097 missense possibly damaging 0.86
R6472:Heatr1 UTSW 13 12434230 missense probably benign 0.29
R6922:Heatr1 UTSW 13 12435075 missense probably benign 0.00
R7077:Heatr1 UTSW 13 12418164 missense possibly damaging 0.63
R7297:Heatr1 UTSW 13 12421060 nonsense probably null
R7445:Heatr1 UTSW 13 12431038 missense possibly damaging 0.70
R7669:Heatr1 UTSW 13 12411262 missense probably benign 0.33
R7672:Heatr1 UTSW 13 12438664 missense probably damaging 0.96
RF011:Heatr1 UTSW 13 12407544 missense probably benign 0.00
Z1176:Heatr1 UTSW 13 12399008 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- GCATGAGTCTGACAACCTTCTCTC -3'
(R):5'- GGCTTGCTGCAACTTTTGTAC -3'

Sequencing Primer
(F):5'- CTTTAGATGGTGCTTGCCCAG -3'
(R):5'- CTTGCTGCAACTTTTGTACAGTAG -3'
Posted On2019-11-26