Incidental Mutation 'R8029:Zscan26'
ID 617847
Institutional Source Beutler Lab
Gene Symbol Zscan26
Ensembl Gene ENSMUSG00000022228
Gene Name zinc finger and SCAN domain containing 26
Synonyms Zfp187
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock # R8029 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 21442180-21453730 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 21445350 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 202 (C202R)
Ref Sequence ENSEMBL: ENSMUSP00000032820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032820] [ENSMUST00000099719] [ENSMUST00000110485] [ENSMUST00000122872] [ENSMUST00000145494] [ENSMUST00000148071] [ENSMUST00000151743]
AlphaFold Q5RJ54
Predicted Effect probably damaging
Transcript: ENSMUST00000032820
AA Change: C202R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032820
Gene: ENSMUSG00000022228
AA Change: C202R

DomainStartEndE-ValueType
ZnF_C2H2 144 166 1.58e-3 SMART
ZnF_C2H2 172 194 6.99e-5 SMART
ZnF_C2H2 200 222 1.67e-2 SMART
ZnF_C2H2 228 250 1.45e-2 SMART
ZnF_C2H2 256 278 2.53e-2 SMART
ZnF_C2H2 284 306 5.14e-3 SMART
ZnF_C2H2 312 334 2.95e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099719
SMART Domains Protein: ENSMUSP00000097307
Gene: ENSMUSG00000055313

DomainStartEndE-ValueType
Blast:SCAN 1 65 7e-14 BLAST
low complexity region 192 204 N/A INTRINSIC
Pfam:DDE_Tnp_1_7 250 411 1.1e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110485
AA Change: C328R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106111
Gene: ENSMUSG00000022228
AA Change: C328R

DomainStartEndE-ValueType
SCAN 38 151 1.58e-48 SMART
ZnF_C2H2 270 292 1.58e-3 SMART
ZnF_C2H2 298 320 6.99e-5 SMART
ZnF_C2H2 326 348 1.67e-2 SMART
ZnF_C2H2 354 376 1.45e-2 SMART
ZnF_C2H2 382 404 2.53e-2 SMART
ZnF_C2H2 410 432 5.14e-3 SMART
ZnF_C2H2 438 460 2.95e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122872
SMART Domains Protein: ENSMUSP00000120175
Gene: ENSMUSG00000055313

DomainStartEndE-ValueType
Blast:SCAN 1 65 1e-13 BLAST
low complexity region 155 167 N/A INTRINSIC
Pfam:DDE_Tnp_1_7 213 374 1.4e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145494
SMART Domains Protein: ENSMUSP00000118503
Gene: ENSMUSG00000055313

DomainStartEndE-ValueType
Blast:SCAN 1 65 8e-15 BLAST
low complexity region 192 204 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148071
SMART Domains Protein: ENSMUSP00000114882
Gene: ENSMUSG00000055313

DomainStartEndE-ValueType
Blast:SCAN 1 65 3e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000151743
SMART Domains Protein: ENSMUSP00000117669
Gene: ENSMUSG00000055313

DomainStartEndE-ValueType
Blast:SCAN 1 65 7e-14 BLAST
low complexity region 192 204 N/A INTRINSIC
Pfam:DDE_Tnp_1_7 250 411 1.7e-42 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,377 H543R possibly damaging Het
Acvr1c A G 2: 58,296,117 I118T possibly damaging Het
Alpk1 T C 3: 127,729,285 D36G possibly damaging Het
Aox2 G A 1: 58,343,668 V1036I probably benign Het
Arhgef1 T C 7: 24,919,738 L468P probably damaging Het
Armc2 A T 10: 41,927,000 L559Q probably damaging Het
Asb3 A T 11: 31,101,180 R506* probably null Het
Asna1 T C 8: 85,019,827 M131V probably benign Het
Aspm A G 1: 139,471,632 H1045R probably benign Het
Cacna1g G T 11: 94,409,738 R2099S probably benign Het
Cd177 C T 7: 24,756,169 W309* probably null Het
Cd34 A C 1: 194,958,552 M242L probably benign Het
Cdh24 T A 14: 54,639,399 N49I probably damaging Het
Ces2b A G 8: 104,834,850 N192S probably damaging Het
Chsy3 A G 18: 59,179,447 I331V possibly damaging Het
Disp1 A G 1: 183,089,288 S523P probably damaging Het
Dlgap5 T C 14: 47,416,440 H44R probably benign Het
Dnajc30 G T 5: 135,064,332 A28S probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Exd1 A T 2: 119,528,723 H226Q probably damaging Het
Gata6 T A 18: 11,054,944 V291E possibly damaging Het
Gfi1b A T 2: 28,613,675 probably null Het
Grk3 T A 5: 112,961,642 I150L probably benign Het
Gstcd C T 3: 133,082,107 V277M probably damaging Het
Idua T C 5: 108,669,412 F17S probably benign Het
Ighg1 T C 12: 113,329,145 K268R Het
Lama1 G T 17: 67,817,594 R2883M Het
Lpar3 T C 3: 146,240,963 M132T probably benign Het
Macf1 T C 4: 123,444,892 T4351A possibly damaging Het
March6 A G 15: 31,496,002 probably null Het
Mbtps1 C A 8: 119,547,805 probably benign Het
Mctp1 T C 13: 77,029,886 Y931H probably damaging Het
Mug2 A G 6: 122,081,545 probably null Het
Myh1 G T 11: 67,211,240 probably null Het
Mylk2 T C 2: 152,920,299 S497P probably damaging Het
Nectin4 A G 1: 171,386,687 D470G probably benign Het
Nop2 C T 6: 125,144,420 P722S possibly damaging Het
Nphp1 T C 2: 127,741,116 T626A probably benign Het
Nudt9 C T 5: 104,050,611 probably benign Het
Olfr1145 A G 2: 87,810,032 T71A probably benign Het
Olfr18 A G 9: 20,314,347 F191S possibly damaging Het
Olfr512 T A 7: 108,713,830 F159Y possibly damaging Het
Olfr835 T C 9: 19,035,794 S224P probably damaging Het
Oplah T C 15: 76,305,696 Y143C probably benign Het
Osbpl1a T G 18: 12,914,521 E125D probably benign Het
P2ry1 C A 3: 61,003,522 N27K possibly damaging Het
Palld A T 8: 61,877,312 I177N probably damaging Het
Plcl1 A T 1: 55,696,078 I193L probably benign Het
Polr1a T A 6: 71,912,956 L53* probably null Het
Ppp1r9a A G 6: 5,057,518 E531G possibly damaging Het
Prex1 C A 2: 166,575,603 Q1361H probably benign Het
Ptprc T C 1: 138,078,459 E795G probably damaging Het
Rars C T 11: 35,821,165 V295I probably damaging Het
Rnaseh2b T C 14: 62,353,548 V116A possibly damaging Het
Rnf43 T A 11: 87,731,894 L480H probably benign Het
Rttn A G 18: 89,090,474 T1601A not run Het
Setd1a C G 7: 127,786,214 Q698E probably benign Het
Sh3gl3 T C 7: 82,270,883 Y100H probably benign Het
Sis T C 3: 72,921,142 Y1200C probably damaging Het
Snx13 A C 12: 35,119,886 H610P probably damaging Het
Spdl1 T C 11: 34,822,592 R217G probably benign Het
Spop G A 11: 95,474,367 E113K probably benign Het
Sult2a3 G A 7: 14,121,628 P101L probably damaging Het
Tbl1xr1 C T 3: 22,200,436 H348Y probably damaging Het
Tmie T C 9: 110,867,487 T109A possibly damaging Het
Ttc12 A G 9: 49,470,251 V140A possibly damaging Het
Ube2m A G 7: 13,036,597 L58P probably damaging Het
Urb1 A G 16: 90,779,152 S839P possibly damaging Het
Vmn2r117 T A 17: 23,477,770 D221V probably benign Het
Vps41 C T 13: 18,823,785 Q263* probably null Het
Zfand3 A T 17: 30,135,433 T75S probably benign Het
Other mutations in Zscan26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Zscan26 APN 13 21445101 missense probably damaging 0.99
IGL00720:Zscan26 APN 13 21445199 missense probably benign 0.00
R0558:Zscan26 UTSW 13 21445055 missense probably benign 0.37
R1236:Zscan26 UTSW 13 21445770 missense probably benign
R1912:Zscan26 UTSW 13 21445140 missense possibly damaging 0.84
R4692:Zscan26 UTSW 13 21445257 missense probably damaging 1.00
R5818:Zscan26 UTSW 13 21445761 missense probably benign 0.00
R6089:Zscan26 UTSW 13 21448329 missense probably damaging 0.97
R9448:Zscan26 UTSW 13 21448261 missense probably benign
Z1088:Zscan26 UTSW 13 21445463 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGGTCGGAGGTCAAGCTG -3'
(R):5'- TCTAAAGACAAAGGTCATCCCTGC -3'

Sequencing Primer
(F):5'- GCTGAAGGCTTTCCCACAC -3'
(R):5'- AAGGTCATCCCTGCCAAGAGTG -3'
Posted On 2020-01-23