Incidental Mutation 'R8278:Rap1gap'
ID638058
Institutional Source Beutler Lab
Gene Symbol Rap1gap
Ensembl Gene ENSMUSG00000041351
Gene NameRap1 GTPase-activating protein
Synonyms1300019I11Rik, 2310004O14Rik, Rap1ga1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8278 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location137664726-137729861 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 137717437 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 254 (S254R)
Ref Sequence ENSEMBL: ENSMUSP00000101461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047243] [ENSMUST00000097837] [ENSMUST00000105835] [ENSMUST00000141306] [ENSMUST00000150928] [ENSMUST00000152567]
Predicted Effect probably damaging
Transcript: ENSMUST00000047243
AA Change: S254R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042473
Gene: ENSMUSG00000041351
AA Change: S254R

DomainStartEndE-ValueType
GoLoco 59 81 4.94e-10 SMART
Pfam:Rap_GAP 274 461 1.4e-64 PFAM
low complexity region 485 495 N/A INTRINSIC
low complexity region 630 641 N/A INTRINSIC
low complexity region 680 695 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097837
AA Change: S221R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095448
Gene: ENSMUSG00000041351
AA Change: S221R

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
GoLoco 26 48 4.94e-10 SMART
Pfam:Rap_GAP 241 428 1.2e-64 PFAM
low complexity region 452 462 N/A INTRINSIC
low complexity region 597 608 N/A INTRINSIC
low complexity region 647 662 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105835
AA Change: S254R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101461
Gene: ENSMUSG00000041351
AA Change: S254R

DomainStartEndE-ValueType
GoLoco 59 81 4.94e-10 SMART
Pfam:Rap_GAP 274 455 4.5e-66 PFAM
low complexity region 485 495 N/A INTRINSIC
low complexity region 630 641 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141306
SMART Domains Protein: ENSMUSP00000122315
Gene: ENSMUSG00000041351

DomainStartEndE-ValueType
Pfam:Rap_GAP 1 117 1.4e-32 PFAM
low complexity region 141 151 N/A INTRINSIC
low complexity region 312 323 N/A INTRINSIC
low complexity region 362 377 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000150928
AA Change: S179R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123561
Gene: ENSMUSG00000041351
AA Change: S179R

DomainStartEndE-ValueType
GoLoco 59 81 4.94e-10 SMART
Pfam:Rap_GAP 199 241 1.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152567
SMART Domains Protein: ENSMUSP00000115391
Gene: ENSMUSG00000041351

DomainStartEndE-ValueType
GoLoco 47 69 4.94e-10 SMART
PDB:1SRQ|D 127 165 4e-20 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type of GTPase-activating-protein (GAP) that down-regulates the activity of the ras-related RAP1 protein. RAP1 acts as a molecular switch by cycling between an inactive GDP-bound form and an active GTP-bound form. The product of this gene, RAP1GAP, promotes the hydrolysis of bound GTP and hence returns RAP1 to the inactive state whereas other proteins, guanine nucleotide exchange factors (GEFs), act as RAP1 activators by facilitating the conversion of RAP1 from the GDP- to the GTP-bound form. In general, ras subfamily proteins, such as RAP1, play key roles in receptor-linked signaling pathways that control cell growth and differentiation. RAP1 plays a role in diverse processes such as cell proliferation, adhesion, differentiation, and embryogenesis. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610301B20Rik T A 4: 10,882,474 probably null Het
4930562C15Rik A T 16: 4,850,176 Q477L probably benign Het
Adcy10 A T 1: 165,503,288 D40V probably damaging Het
Cab39l T C 14: 59,539,113 Y248H probably damaging Het
Casr G T 16: 36,515,649 D99E probably damaging Het
Cdh16 T C 8: 104,618,475 E364G probably benign Het
Cep104 C T 4: 153,983,665 T189I possibly damaging Het
Chd7 T A 4: 8,862,485 probably null Het
Chit1 G A 1: 134,150,594 R380Q probably benign Het
Cpne2 A G 8: 94,554,688 K174R probably damaging Het
Dchs2 T A 3: 83,271,003 I1121N probably damaging Het
Fgf6 A T 6: 127,015,818 Y78F probably damaging Het
H2-T10 A T 17: 36,118,940 N320K probably benign Het
Heatr3 A T 8: 88,156,733 N398I possibly damaging Het
Hrh4 T C 18: 13,007,227 S60P probably damaging Het
Ikbip A G 10: 91,096,328 H278R probably benign Het
Jmy A T 13: 93,464,716 I394N probably damaging Het
Klhl8 T C 5: 103,874,241 E314G probably benign Het
Lhx9 A T 1: 138,838,586 C164S probably damaging Het
Loxl3 G T 6: 83,048,716 G352C probably damaging Het
Lrrk1 A G 7: 66,278,684 F1232S probably benign Het
Mpnd A G 17: 56,012,469 T311A probably benign Het
Mpp7 A T 18: 7,444,025 D132E probably benign Het
Nck2 T C 1: 43,554,580 S316P probably damaging Het
Nckap5 T C 1: 126,027,772 S348G probably damaging Het
Nyap1 C T 5: 137,731,815 R790H probably damaging Het
Olfr1489 C T 19: 13,633,594 T161I possibly damaging Het
Park2 A T 17: 12,050,722 N421Y probably benign Het
Pdcd11 G A 19: 47,106,297 V507I probably damaging Het
Pdzd2 T C 15: 12,375,909 H1380R probably benign Het
Pgap1 C T 1: 54,490,271 V763I probably benign Het
Pnmal2 G T 7: 16,946,338 V416L probably damaging Het
Prpf4 T C 4: 62,415,256 probably null Het
Psmb5 C T 14: 54,617,885 G36D probably benign Het
Ptprq A G 10: 107,686,378 S571P possibly damaging Het
Rufy2 A T 10: 63,007,693 D492V probably benign Het
Ryr2 C A 13: 11,595,506 E4145* probably null Het
Sgsm1 A G 5: 113,260,092 F898L probably damaging Het
Slc26a9 C A 1: 131,761,776 A487D possibly damaging Het
Slc6a15 T C 10: 103,394,029 probably null Het
Smad9 A T 3: 54,789,266 T251S probably benign Het
Socs3 A T 11: 117,967,652 C193* probably null Het
Sox6 T A 7: 115,476,964 D813V probably damaging Het
Taf2 A T 15: 55,065,965 L65* probably null Het
Taf6 G A 5: 138,179,835 A468V probably benign Het
Tmem71 T C 15: 66,555,112 D78G probably damaging Het
Tob2 T C 15: 81,851,087 N227S probably benign Het
Trim34a C A 7: 104,249,416 Q180K probably damaging Het
Ugt1a9 T C 1: 88,071,656 L276P possibly damaging Het
Wdr33 G A 18: 31,827,352 R23Q possibly damaging Het
Wnt7b T G 15: 85,543,686 N189H Het
Zfp609 G A 9: 65,697,522 A1308V possibly damaging Het
Other mutations in Rap1gap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Rap1gap APN 4 137716524 missense probably damaging 0.98
IGL01810:Rap1gap APN 4 137716155 missense probably benign 0.07
IGL01944:Rap1gap APN 4 137725620 missense probably damaging 1.00
IGL02117:Rap1gap APN 4 137727044 missense probably damaging 0.98
IGL02271:Rap1gap APN 4 137718006 missense probably damaging 1.00
IGL02272:Rap1gap APN 4 137716566 missense probably damaging 1.00
IGL02590:Rap1gap APN 4 137720300 missense probably damaging 0.98
IGL02626:Rap1gap APN 4 137727053 missense probably benign 0.00
IGL03211:Rap1gap APN 4 137715846 critical splice donor site probably null
R0243:Rap1gap UTSW 4 137719351 missense probably damaging 0.99
R1239:Rap1gap UTSW 4 137717996 missense probably damaging 1.00
R1246:Rap1gap UTSW 4 137712094 missense possibly damaging 0.86
R2264:Rap1gap UTSW 4 137727723 missense probably benign
R2935:Rap1gap UTSW 4 137724731 missense probably benign 0.19
R3840:Rap1gap UTSW 4 137717447 missense probably damaging 1.00
R3841:Rap1gap UTSW 4 137717447 missense probably damaging 1.00
R4619:Rap1gap UTSW 4 137716111 missense probably damaging 1.00
R4821:Rap1gap UTSW 4 137712129 missense probably damaging 0.99
R4998:Rap1gap UTSW 4 137728284 missense possibly damaging 0.80
R5061:Rap1gap UTSW 4 137720433 critical splice donor site probably null
R5800:Rap1gap UTSW 4 137720377 missense probably benign 0.00
R6259:Rap1gap UTSW 4 137681757 critical splice donor site probably null
R7082:Rap1gap UTSW 4 137718936 missense probably damaging 1.00
R7098:Rap1gap UTSW 4 137716082 splice site probably null
R7234:Rap1gap UTSW 4 137728540 nonsense probably null
R7580:Rap1gap UTSW 4 137719982 missense possibly damaging 0.94
R8097:Rap1gap UTSW 4 137728286 missense probably benign 0.02
R8196:Rap1gap UTSW 4 137717964 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CTGAAGCCTTTGAAAGCGAGG -3'
(R):5'- TCTTCCTCAGAGGTCTGGAG -3'

Sequencing Primer
(F):5'- CGAGGGGCTGGGGAAGG -3'
(R):5'- CAGAGTGGCCATGAGCAGTC -3'
Posted On2020-07-28