Mutagenetix > Incidental Mutation

Incidental Mutation 'R8134:Phf3'

651987

Institutional Source

Beutler Lab

Gene Symbol

Phf3

Ensembl Gene

ENSMUSG00000048874

Gene Name

PHD finger protein 3

Synonyms

AU020177, 2310061N19Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8134 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

30802339-30873921 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 30824471 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 152 (V152A)

Ref Sequence

ENSEMBL: ENSMUSP00000140746 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088310] [ENSMUST00000186733] [ENSMUST00000191064]

AlphaFold

B2RQG2

Predicted Effect

silent
Transcript: ENSMUST00000088310

SMART Domains

Protein: ENSMUSP00000085650
Gene: ENSMUSG00000048874

Domain	Start	End	E-Value	Type
low complexity region	212	223	N/A	INTRINSIC
low complexity region	337	344	N/A	INTRINSIC
low complexity region	600	611	N/A	INTRINSIC
low complexity region	651	660	N/A	INTRINSIC
PHD	697	748	3.82e-10	SMART
low complexity region	847	859	N/A	INTRINSIC
low complexity region	876	887	N/A	INTRINSIC
TFS2M	908	1008	1.28e-47	SMART
Pfam:SPOC	1188	1294	4.2e-26	PFAM
low complexity region	1367	1373	N/A	INTRINSIC
low complexity region	1516	1529	N/A	INTRINSIC
low complexity region	1597	1620	N/A	INTRINSIC
low complexity region	1796	1811	N/A	INTRINSIC
low complexity region	1813	1846	N/A	INTRINSIC

Predicted Effect

silent
Transcript: ENSMUST00000186733

SMART Domains

Protein: ENSMUSP00000139610
Gene: ENSMUSG00000048874

Domain	Start	End	E-Value	Type
low complexity region	212	223	N/A	INTRINSIC
low complexity region	337	344	N/A	INTRINSIC
low complexity region	600	611	N/A	INTRINSIC
low complexity region	651	660	N/A	INTRINSIC
PHD	697	748	3.82e-10	SMART
low complexity region	847	859	N/A	INTRINSIC
low complexity region	876	887	N/A	INTRINSIC
TFS2M	908	1008	1.28e-47	SMART
Pfam:SPOC	1188	1294	4.2e-26	PFAM
low complexity region	1367	1373	N/A	INTRINSIC
low complexity region	1516	1529	N/A	INTRINSIC
low complexity region	1597	1620	N/A	INTRINSIC
low complexity region	1796	1811	N/A	INTRINSIC
low complexity region	1813	1846	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000191064
AA Change: V152A

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.5%
20x: 93.5%

Validation Efficiency

99% (71/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a PHD finger-containing gene family. This gene may function as a transcription factor and may be involved in glioblastomas development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abce1	G	A	8: 79,699,353	P265L	probably benign	Het
Adam20	A	G	8: 40,796,064	T404A	probably benign	Het
Anp32a	G	T	9: 62,377,581	R237L	unknown	Het
Ascc3	A	G	10: 50,767,458	D1835G	probably benign	Het
Atg9b	A	G	5: 24,385,222		probably null	Het
Bard1	A	T	1: 71,067,138	N443K	probably damaging	Het
Btnl1	A	G	17: 34,385,673	D476G	possibly damaging	Het
C2cd3	A	T	7: 100,418,504	I487F		Het
Cadm4	A	G	7: 24,503,605	E384G	possibly damaging	Het
Camsap3	A	G	8: 3,598,075	K128E	probably benign	Het
Casz1	C	T	4: 148,943,035	P1005S	probably damaging	Het
Cd38	C	A	5: 43,901,448	L135M	probably damaging	Het
Cdk20	A	G	13: 64,437,920	E244G	probably benign	Het
Cfap54	A	T	10: 92,878,516	V2667D	unknown	Het
Col11a1	A	G	3: 114,218,786	K1792E	unknown	Het
Cpne9	A	T	6: 113,295,042	D377V	probably benign	Het
Csmd1	A	T	8: 15,932,550	C2706S	probably damaging	Het
Ctnnbl1	T	C	2: 157,809,471	V222A	probably benign	Het
Frmpd2	T	C	14: 33,505,495	S277P	probably benign	Het
Gm15922	A	G	7: 3,735,839	S590P	probably damaging	Het
Herc2	C	T	7: 56,085,136	T158I	probably benign	Het
Hoxa4	G	T	6: 52,190,557	H215N	possibly damaging	Het
Hpd	G	T	5: 123,174,380	Q309K	probably benign	Het
Il20ra	A	G	10: 19,750,704	T159A	probably damaging	Het
Ints10	T	A	8: 68,802,986	Y209*	probably null	Het
Ints2	A	G	11: 86,212,660	I1190T	probably damaging	Het
Jhy	A	G	9: 40,960,892	V107A	probably null	Het
Kdm4d	C	T	9: 14,463,236	R442H	probably damaging	Het
Kif1bp	T	C	10: 62,577,977	Y134C	probably benign	Het
Klb	A	T	5: 65,383,615	H1017L	probably benign	Het
Kndc1	T	A	7: 139,901,369		probably null	Het
Krtap4-1	GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC	GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC	11: 99,627,834		probably benign	Het
Lrrn3	T	C	12: 41,453,048	I423M	probably damaging	Het
Magi2	T	G	5: 20,391,367	F274L	probably damaging	Het
Magi2	T	A	5: 20,391,394	D283E	probably benign	Het
Map3k19	A	C	1: 127,823,755	S620A	probably damaging	Het
Meis2	C	T	2: 115,866,888	M388I	probably benign	Het
Ms4a3	G	C	19: 11,638,249	H54Q	probably benign	Het
Nfe2l1	A	T	11: 96,819,759	M548K	possibly damaging	Het
Ninl	C	T	2: 150,950,314	C763Y	probably benign	Het
Numa1	T	C	7: 102,001,627	F1522L	probably benign	Het
Olfr1344	T	C	7: 6,438,923		probably benign	Het
Olfr539	T	A	7: 140,667,767	I153N	possibly damaging	Het
Pcdhgc3	G	A	18: 37,806,863	V106I	probably benign	Het
Plcg2	A	T	8: 117,557,318	D118V	probably damaging	Het
Pnpla1	A	G	17: 28,878,469	D203G	probably damaging	Het
Ppip5k2	A	T	1: 97,745,163	M474K	probably benign	Het
Ppp1r12b	T	C	1: 134,886,542	E341G	possibly damaging	Het
Rictor	C	T	15: 6,772,154	S441L	probably benign	Het
Rrs1	C	T	1: 9,545,420		probably benign	Het
Scaf11	T	C	15: 96,420,711	N324S	probably damaging	Het
Spaca1	T	A	4: 34,042,157		probably null	Het
Sun3	G	T	11: 9,029,346	D118E	probably benign	Het
Svop	C	T	5: 114,042,931	V215I	probably benign	Het
Tbc1d15	A	T	10: 115,209,569	C497S	probably damaging	Het
Tdrd6	A	T	17: 43,626,173	I1328N	probably damaging	Het
Tuba8	T	A	6: 121,221,422	D116E	probably benign	Het
Ube2z	A	G	11: 96,058,374	I213T	possibly damaging	Het
Ubqln4	G	A	3: 88,555,490		probably null	Het
Vps13a	A	G	19: 16,654,354	I2639T	possibly damaging	Het
Zfp217	G	A	2: 170,119,651	S252F	possibly damaging	Het
Zfp94	A	T	7: 24,303,741	V92E	probably benign	Het

Other mutations in Phf3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Phf3	APN	1	30811847	missense	probably damaging	0.99
IGL00704:Phf3	APN	1	30804838	missense	probably benign
IGL01147:Phf3	APN	1	30804169	missense	probably damaging	1.00
IGL01360:Phf3	APN	1	30808728	missense	probably damaging	1.00
IGL01376:Phf3	APN	1	30830485	missense	possibly damaging	0.62
IGL01396:Phf3	APN	1	30804305	nonsense	probably null
IGL01830:Phf3	APN	1	30814067	nonsense	probably null
IGL02108:Phf3	APN	1	30829951	missense	probably damaging	1.00
IGL02156:Phf3	APN	1	30808778	missense	probably damaging	1.00
IGL02576:Phf3	APN	1	30830036	missense	probably benign	0.01
IGL03031:Phf3	APN	1	30804653	missense	probably benign	0.00
IGL03334:Phf3	APN	1	30805729	missense	probably damaging	0.99
IGL03411:Phf3	APN	1	30804401	missense	probably damaging	1.00
FR4976:Phf3	UTSW	1	30805023	utr 3 prime	probably benign
PIT4458001:Phf3	UTSW	1	30816541	missense	probably damaging	1.00
R0037:Phf3	UTSW	1	30804918	missense	probably benign	0.03
R0052:Phf3	UTSW	1	30808767	missense	probably damaging	1.00
R0114:Phf3	UTSW	1	30805443	missense	possibly damaging	0.87
R0123:Phf3	UTSW	1	30805065	missense	probably benign	0.01
R0225:Phf3	UTSW	1	30805065	missense	probably benign	0.01
R0715:Phf3	UTSW	1	30811838	missense	probably damaging	1.00
R0835:Phf3	UTSW	1	30830551	missense	probably benign	0.02
R0848:Phf3	UTSW	1	30863172	missense	probably damaging	1.00
R1473:Phf3	UTSW	1	30805940	missense	probably damaging	1.00
R1522:Phf3	UTSW	1	30805648	missense	probably benign	0.05
R1549:Phf3	UTSW	1	30804842	missense	probably benign	0.00
R1555:Phf3	UTSW	1	30805877	missense	possibly damaging	0.86
R1780:Phf3	UTSW	1	30811942	missense	probably damaging	1.00
R1789:Phf3	UTSW	1	30806206	missense	probably damaging	1.00
R1875:Phf3	UTSW	1	30830623	missense	possibly damaging	0.81
R1912:Phf3	UTSW	1	30804345	missense	probably damaging	1.00
R1957:Phf3	UTSW	1	30831520	missense	probably damaging	1.00
R2019:Phf3	UTSW	1	30811847	missense	probably damaging	0.99
R2259:Phf3	UTSW	1	30804343	missense	probably benign	0.20
R2305:Phf3	UTSW	1	30805475	nonsense	probably null
R2345:Phf3	UTSW	1	30805351	nonsense	probably null
R2424:Phf3	UTSW	1	30806349	missense	probably damaging	1.00
R2497:Phf3	UTSW	1	30830014	missense	probably damaging	1.00
R2504:Phf3	UTSW	1	30810789	missense	probably damaging	1.00
R3522:Phf3	UTSW	1	30805603	missense	probably damaging	1.00
R3816:Phf3	UTSW	1	30805753	missense	probably damaging	1.00
R4152:Phf3	UTSW	1	30831458	missense	probably benign	0.13
R4403:Phf3	UTSW	1	30804409	missense	probably damaging	1.00
R4658:Phf3	UTSW	1	30863088	missense	probably damaging	1.00
R4663:Phf3	UTSW	1	30821215	missense	probably damaging	1.00
R4669:Phf3	UTSW	1	30829946	missense	probably damaging	1.00
R4706:Phf3	UTSW	1	30805606	missense	probably damaging	1.00
R4757:Phf3	UTSW	1	30820827	missense	probably damaging	1.00
R4766:Phf3	UTSW	1	30813939	unclassified	probably benign
R4786:Phf3	UTSW	1	30816557	nonsense	probably null
R5107:Phf3	UTSW	1	30831485	missense	probably benign	0.03
R5155:Phf3	UTSW	1	30824376	missense	possibly damaging	0.87
R5310:Phf3	UTSW	1	30803806	missense	probably damaging	1.00
R5823:Phf3	UTSW	1	30804683	missense	probably damaging	1.00
R5944:Phf3	UTSW	1	30820704	missense	probably damaging	1.00
R5979:Phf3	UTSW	1	30805746	missense	probably damaging	1.00
R6007:Phf3	UTSW	1	30804345	missense	probably damaging	1.00
R6024:Phf3	UTSW	1	30863226	missense	probably damaging	1.00
R6072:Phf3	UTSW	1	30830688	missense	probably benign	0.08
R6533:Phf3	UTSW	1	30806318	missense	probably damaging	1.00
R6649:Phf3	UTSW	1	30805023	missense	possibly damaging	0.75
R6653:Phf3	UTSW	1	30805023	missense	possibly damaging	0.75
R6852:Phf3	UTSW	1	30804630	missense	probably damaging	0.97
R6855:Phf3	UTSW	1	30820123	missense	probably damaging	1.00
R6862:Phf3	UTSW	1	30813982	missense	probably damaging	1.00
R6930:Phf3	UTSW	1	30811877	missense	probably damaging	1.00
R7135:Phf3	UTSW	1	30831109	missense	possibly damaging	0.61
R7323:Phf3	UTSW	1	30813130	missense	probably benign	0.01
R7352:Phf3	UTSW	1	30804326	missense	possibly damaging	0.87
R7455:Phf3	UTSW	1	30837158	missense	probably damaging	0.96
R7549:Phf3	UTSW	1	30831475	missense	probably benign	0.01
R7609:Phf3	UTSW	1	30805501	missense	probably benign	0.05
R7720:Phf3	UTSW	1	30829857	missense	probably damaging	1.00
R7745:Phf3	UTSW	1	30804224	missense	probably damaging	1.00
R8264:Phf3	UTSW	1	30831057	missense	possibly damaging	0.48
R8545:Phf3	UTSW	1	30824310	missense	possibly damaging	0.48
R8821:Phf3	UTSW	1	30821266	nonsense	probably null
R8831:Phf3	UTSW	1	30821266	nonsense	probably null
R8873:Phf3	UTSW	1	30804692	missense	possibly damaging	0.74
R9101:Phf3	UTSW	1	30803945	missense	possibly damaging	0.56
R9402:Phf3	UTSW	1	30811847	missense	probably damaging	0.99
R9426:Phf3	UTSW	1	30831544	nonsense	probably null
R9594:Phf3	UTSW	1	30829922	missense	probably benign	0.07
R9707:Phf3	UTSW	1	30829842	critical splice donor site	probably null
R9803:Phf3	UTSW	1	30830791	missense	probably benign	0.16
Z1177:Phf3	UTSW	1	30804295	missense	probably damaging	1.00
Z1177:Phf3	UTSW	1	30805051	missense	unknown
Z1177:Phf3	UTSW	1	30811968	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- CAGGGTCATCTGAGTGTCTG -3'
(R):5'- TGCTCCTTGGGAACTTGCTC -3'

Sequencing Primer
(F):5'- GATGATGTCAGCTTTCCACAC -3'
(R):5'- GGAACTTGCTCTGTGTTGAAC -3'

Posted On

2020-09-18